Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0706124766:

Variant ID: vg0706124766 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 6124766
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATGGGAAACTGTGTGATAATCCTAAAGATTACACACACTAGTAATCCTGAAGATTACGCATGACCAATTTATGTCGACCCTGCACATCGTATTTACCTG[T/C]
CGTAAATACTAAATGATGTTGCAGAACATGTCGGACATAGTAAAGAAGGAATTCACCGAGCTTGCCTTGGATGGTAGTAACTACCTCACTTGGGCATTGG

Reverse complement sequence

CCAATGCCCAAGTGAGGTAGTTACTACCATCCAAGGCAAGCTCGGTGAATTCCTTCTTTACTATGTCCGACATGTTCTGCAACATCATTTAGTATTTACG[A/G]
CAGGTAAATACGATGTGCAGGGTCGACATAAATTGGTCATGCGTAATCTTCAGGATTACTAGTGTGTGTAATCTTTAGGATTATCACACAGTTTCCCATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.60%	13.30%	0.13%	0.00%	NA
All Indica	2759	86.30%	13.60%	0.14%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	8.90%	90.30%	0.74%	0.00%	NA
Indica I	595	80.50%	19.00%	0.50%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	87.40%	12.50%	0.11%	0.00%	NA
Indica Intermediate	786	81.30%	18.70%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0706124766	T -> C	LOC_Os07g11070.1	upstream_gene_variant ; 2994.0bp to feature; MODIFIER	silent_mutation	Average:38.783; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg0706124766	T -> C	LOC_Os07g11080.1	upstream_gene_variant ; 28.0bp to feature; MODIFIER	silent_mutation	Average:38.783; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg0706124766	T -> C	LOC_Os07g11090.1	upstream_gene_variant ; 3501.0bp to feature; MODIFIER	silent_mutation	Average:38.783; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N
vg0706124766	T -> C	LOC_Os07g11070-LOC_Os07g11080	intergenic_region ; MODIFIER	silent_mutation	Average:38.783; most accessible tissue: Minghui63 flag leaf, score: 47.544	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0706124766	NA	1.04E-07	mr1063	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	8.56E-06	mr1177	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	8.63E-07	mr1177	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	4.19E-08	mr1220	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	1.52E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	2.61E-07	mr1343	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	4.18E-07	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	5.61E-08	mr1422	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	4.72E-06	1.10E-06	mr1788	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	8.27E-06	mr1806	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	3.26E-06	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	3.46E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	2.11E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	1.15E-08	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	1.53E-08	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	2.61E-06	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	5.51E-06	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	2.55E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0706124766	NA	2.42E-08	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251