\
| Variant ID: vg0706102792 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6102792 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACTTTGACTTCTTAATTCTATAAAAATATTTATTAAAAAGTGATATATGTATACTTGTATGAAAGTATTTTTCAAGACCAATCTATTCATATAATTTTTA[T/C]
ATTTTCAAACTCAATAACTTAAGAGTTATTCATGATTTATATTCCCAAGGTTTGACTTAAACATTGTCCTAAACGACTTCCTTTACGAGTACGGAGGAGT
ACTCCTCCGTACTCGTAAAGGAAGTCGTTTAGGACAATGTTTAAGTCAAACCTTGGGAATATAAATCATGAATAACTCTTAAGTTATTGAGTTTGAAAAT[A/G]
TAAAAATTATATGAATAGATTGGTCTTGAAAAATACTTTCATACAAGTATACATATATCACTTTTTAATAAATATTTTTATAGAATTAAGAAGTCAAAGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.10% | 13.40% | 3.49% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 1.30% | 1.05% | 0.00% | NA |
| All Japonica | 1512 | 52.70% | 38.60% | 8.73% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 96.80% | 2.00% | 1.18% | 0.00% | NA |
| Indica II | 465 | 95.10% | 3.20% | 1.72% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 97.20% | 1.10% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 29.70% | 57.90% | 12.39% | 0.00% | NA |
| Tropical Japonica | 504 | 87.10% | 8.90% | 3.97% | 0.00% | NA |
| Japonica Intermediate | 241 | 53.90% | 39.00% | 7.05% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 12.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706102792 | T -> C | LOC_Os07g11050-LOC_Os07g11060 | intergenic_region ; MODIFIER | silent_mutation | Average:36.574; most accessible tissue: Minghui63 panicle, score: 53.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706102792 | 9.15E-06 | NA | mr1115 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706102792 | NA | 1.49E-08 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706102792 | 8.54E-06 | 2.20E-06 | mr1387 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706102792 | 7.75E-06 | 7.73E-06 | mr1494 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706102792 | NA | 6.68E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706102792 | NA | 2.06E-11 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706102792 | NA | 2.88E-07 | mr1654 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706102792 | 2.12E-08 | NA | mr1773 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706102792 | 6.68E-06 | 6.67E-06 | mr1773 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706102792 | 6.86E-06 | NA | mr1811 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706102792 | 7.47E-08 | 6.42E-06 | mr1816 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706102792 | NA | 1.46E-06 | mr1880 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706102792 | NA | 7.67E-08 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706102792 | NA | 1.18E-06 | mr1282_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |