| Variant ID: vg0706078197 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6078197 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTGGATAAATCGTAATAAGCAAATATAATTAATAAAAATTCCAATAATCATATATACTTAGCATATATATATGAATGATATTATTATATTGGTAAAAACT[C/G]
TAATTAAGATATGTATGTACATACTGCATGATTTAAAATTAATAAAAATTGTAATCATCATATGTACTTAGCGTAGGAATTATATTAAATTAAATGCTAA
TTAGCATTTAATTTAATATAATTCCTACGCTAAGTACATATGATGATTACAATTTTTATTAATTTTAAATCATGCAGTATGTACATACATATCTTAATTA[G/C]
AGTTTTTACCAATATAATAATATCATTCATATATATATGCTAAGTATATATGATTATTGGAATTTTTATTAATTATATTTGCTTATTACGATTTATCCAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.70% | 1.00% | 9.63% | 3.77% | NA |
| All Indica | 2759 | 84.80% | 1.60% | 10.47% | 3.12% | NA |
| All Japonica | 1512 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Aus | 269 | 9.30% | 0.00% | 57.99% | 32.71% | NA |
| Indica I | 595 | 78.70% | 0.80% | 17.82% | 2.69% | NA |
| Indica II | 465 | 98.90% | 0.00% | 1.08% | 0.00% | NA |
| Indica III | 913 | 85.00% | 2.40% | 8.65% | 3.94% | NA |
| Indica Intermediate | 786 | 80.80% | 2.30% | 12.60% | 4.33% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 0.00% | 6.67% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706078197 | C -> DEL | N | N | silent_mutation | Average:11.507; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0706078197 | C -> G | LOC_Os07g11030.1 | upstream_gene_variant ; 967.0bp to feature; MODIFIER | silent_mutation | Average:11.507; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0706078197 | C -> G | LOC_Os07g11040.1 | downstream_gene_variant ; 627.0bp to feature; MODIFIER | silent_mutation | Average:11.507; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| vg0706078197 | C -> G | LOC_Os07g11030-LOC_Os07g11040 | intergenic_region ; MODIFIER | silent_mutation | Average:11.507; most accessible tissue: Minghui63 panicle, score: 20.733 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706078197 | NA | 4.43E-07 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706078197 | NA | 3.53E-06 | mr1806 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706078197 | 5.88E-06 | 1.18E-08 | mr1348_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706078197 | NA | 3.80E-06 | mr1348_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706078197 | NA | 1.62E-11 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |