\
| Variant ID: vg0706052872 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 6052872 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )
TTGTCCTTTTCTTTTTCTCTCCAAATCGTGATTTTTCCAAAGGAAAAAAAGTTTTTTTCCTTGTCCCTCAACTCTTGGTTTGGTTTGGTTTGTATTTCTC[G/A]
TCTCCAAAACTGATAAAACTCGTCCGTCAACTCTCAAAACTGTTTAGATCTCACCTCTCACTCGTTTATAAGTGGTTTTTGACCTACTTGGTGTAGATAT
ATATCTACACCAAGTAGGTCAAAAACCACTTATAAACGAGTGAGAGGTGAGATCTAAACAGTTTTGAGAGTTGACGGACGAGTTTTATCAGTTTTGGAGA[C/T]
GAGAAATACAAACCAAACCAAACCAAGAGTTGAGGGACAAGGAAAAAAACTTTTTTTCCTTTGGAAAAATCACGATTTGGAGAGAAAAAGAAAAGGACAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 5.60% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 97.40% | 2.60% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 30.50% | 69.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.50% | 3.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0706052872 | G -> A | LOC_Os07g11010.1 | intron_variant ; MODIFIER | silent_mutation | Average:57.806; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| vg0706052872 | G -> A | LOC_Os07g11010.2 | intron_variant ; MODIFIER | silent_mutation | Average:57.806; most accessible tissue: Zhenshan97 young leaf, score: 69.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0706052872 | NA | 6.99E-43 | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706052872 | NA | 2.40E-06 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706052872 | NA | 8.77E-20 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706052872 | 8.53E-06 | NA | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706052872 | 4.63E-06 | NA | mr1243_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706052872 | 8.50E-06 | NA | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706052872 | NA | 5.03E-43 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706052872 | NA | 2.57E-29 | mr1757_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706052872 | NA | 5.19E-07 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0706052872 | NA | 7.63E-10 | mr1818_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |