\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705940927:

Variant ID: vg0705940927 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5940927
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCCAGCAGCGGCTACGTCTTCGGGCGTCGTAACCTCCTTGGGCGTTGTCAAGGGTTACCATCTTCCTTTCTCGACGAGCTTCTTTAGGTGAAAACTGTTA[G/T]
AATAGGTGTCGAATATACTTCCTATTTGGTTACAGTTGGACTTAGAGTTGTAATAGGTGTTAGGGGATGGAGTTAGAGTCAGACTCTGTAACCCATCATC

Reverse complement sequence

GATGATGGGTTACAGAGTCTGACTCTAACTCCATCCCCTAACACCTATTACAACTCTAAGTCCAACTGTAACCAAATAGGAAGTATATTCGACACCTATT[C/A]
TAACAGTTTTCACCTAAAGAAGCTCGTCGAGAAAGGAAGATGGTAACCCTTGACAACGCCCAAGGAGGTTACGACGCCCGAAGACGTAGCCGCTGCTGGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 4.00% 0.21% 4.04% NA
All Indica  2759 98.40% 0.20% 0.04% 1.38% NA
All Japonica  1512 93.50% 6.20% 0.40% 0.00% NA
Aus  269 44.20% 0.00% 0.37% 55.39% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.00% 0.00% 0.22% NA
Indica III  913 98.00% 0.20% 0.00% 1.75% NA
Indica Intermediate  786 96.70% 0.50% 0.13% 2.67% NA
Temperate Japonica  767 98.00% 1.30% 0.65% 0.00% NA
Tropical Japonica  504 95.00% 5.00% 0.00% 0.00% NA
Japonica Intermediate  241 75.50% 24.10% 0.41% 0.00% NA
VI/Aromatic  96 13.50% 84.40% 2.08% 0.00% NA
Intermediate  90 85.60% 10.00% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705940927 G -> DEL N N silent_mutation Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0705940927 G -> T LOC_Os07g10880.1 upstream_gene_variant ; 3804.0bp to feature; MODIFIER silent_mutation Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0705940927 G -> T LOC_Os07g10860.1 downstream_gene_variant ; 1658.0bp to feature; MODIFIER silent_mutation Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0705940927 G -> T LOC_Os07g10870.1 downstream_gene_variant ; 947.0bp to feature; MODIFIER silent_mutation Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N
vg0705940927 G -> T LOC_Os07g10860-LOC_Os07g10870 intergenic_region ; MODIFIER silent_mutation Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705940927 NA 1.17E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705940927 NA 9.87E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705940927 NA 1.88E-06 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705940927 9.74E-07 1.96E-08 mr1962 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251