| Variant ID: vg0705940927 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5940927 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCCAGCAGCGGCTACGTCTTCGGGCGTCGTAACCTCCTTGGGCGTTGTCAAGGGTTACCATCTTCCTTTCTCGACGAGCTTCTTTAGGTGAAAACTGTTA[G/T]
AATAGGTGTCGAATATACTTCCTATTTGGTTACAGTTGGACTTAGAGTTGTAATAGGTGTTAGGGGATGGAGTTAGAGTCAGACTCTGTAACCCATCATC
GATGATGGGTTACAGAGTCTGACTCTAACTCCATCCCCTAACACCTATTACAACTCTAAGTCCAACTGTAACCAAATAGGAAGTATATTCGACACCTATT[C/A]
TAACAGTTTTCACCTAAAGAAGCTCGTCGAGAAAGGAAGATGGTAACCCTTGACAACGCCCAAGGAGGTTACGACGCCCGAAGACGTAGCCGCTGCTGGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.70% | 4.00% | 0.21% | 4.04% | NA |
| All Indica | 2759 | 98.40% | 0.20% | 0.04% | 1.38% | NA |
| All Japonica | 1512 | 93.50% | 6.20% | 0.40% | 0.00% | NA |
| Aus | 269 | 44.20% | 0.00% | 0.37% | 55.39% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 98.00% | 0.20% | 0.00% | 1.75% | NA |
| Indica Intermediate | 786 | 96.70% | 0.50% | 0.13% | 2.67% | NA |
| Temperate Japonica | 767 | 98.00% | 1.30% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 24.10% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 13.50% | 84.40% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 85.60% | 10.00% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705940927 | G -> DEL | N | N | silent_mutation | Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| vg0705940927 | G -> T | LOC_Os07g10880.1 | upstream_gene_variant ; 3804.0bp to feature; MODIFIER | silent_mutation | Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| vg0705940927 | G -> T | LOC_Os07g10860.1 | downstream_gene_variant ; 1658.0bp to feature; MODIFIER | silent_mutation | Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| vg0705940927 | G -> T | LOC_Os07g10870.1 | downstream_gene_variant ; 947.0bp to feature; MODIFIER | silent_mutation | Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| vg0705940927 | G -> T | LOC_Os07g10860-LOC_Os07g10870 | intergenic_region ; MODIFIER | silent_mutation | Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705940927 | NA | 1.17E-06 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705940927 | NA | 9.87E-06 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705940927 | NA | 1.88E-06 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705940927 | 9.74E-07 | 1.96E-08 | mr1962 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/