Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705940927:

Variant ID: vg0705940927 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 5940927
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCCAGCAGCGGCTACGTCTTCGGGCGTCGTAACCTCCTTGGGCGTTGTCAAGGGTTACCATCTTCCTTTCTCGACGAGCTTCTTTAGGTGAAAACTGTTA[G/T]
AATAGGTGTCGAATATACTTCCTATTTGGTTACAGTTGGACTTAGAGTTGTAATAGGTGTTAGGGGATGGAGTTAGAGTCAGACTCTGTAACCCATCATC

Reverse complement sequence

GATGATGGGTTACAGAGTCTGACTCTAACTCCATCCCCTAACACCTATTACAACTCTAAGTCCAACTGTAACCAAATAGGAAGTATATTCGACACCTATT[C/A]
TAACAGTTTTCACCTAAAGAAGCTCGTCGAGAAAGGAAGATGGTAACCCTTGACAACGCCCAAGGAGGTTACGACGCCCGAAGACGTAGCCGCTGCTGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.70%	4.00%	0.21%	4.04%	NA
All Indica	2759	98.40%	0.20%	0.04%	1.38%	NA
All Japonica	1512	93.50%	6.20%	0.40%	0.00%	NA
Aus	269	44.20%	0.00%	0.37%	55.39%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.00%	0.00%	0.22%	NA
Indica III	913	98.00%	0.20%	0.00%	1.75%	NA
Indica Intermediate	786	96.70%	0.50%	0.13%	2.67%	NA
Temperate Japonica	767	98.00%	1.30%	0.65%	0.00%	NA
Tropical Japonica	504	95.00%	5.00%	0.00%	0.00%	NA
Japonica Intermediate	241	75.50%	24.10%	0.41%	0.00%	NA
VI/Aromatic	96	13.50%	84.40%	2.08%	0.00%	NA
Intermediate	90	85.60%	10.00%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0705940927	G -> DEL	N	N	silent_mutation	Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0705940927	G -> T	LOC_Os07g10880.1	upstream_gene_variant ; 3804.0bp to feature; MODIFIER	silent_mutation	Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0705940927	G -> T	LOC_Os07g10860.1	downstream_gene_variant ; 1658.0bp to feature; MODIFIER	silent_mutation	Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0705940927	G -> T	LOC_Os07g10870.1	downstream_gene_variant ; 947.0bp to feature; MODIFIER	silent_mutation	Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N
vg0705940927	G -> T	LOC_Os07g10860-LOC_Os07g10870	intergenic_region ; MODIFIER	silent_mutation	Average:72.362; most accessible tissue: Minghui63 flag leaf, score: 82.521	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0705940927	NA	1.17E-06	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705940927	NA	9.87E-06	mr1395	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705940927	NA	1.88E-06	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705940927	9.74E-07	1.96E-08	mr1962	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251