Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705638810:

Variant ID: vg0705638810 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 5638810
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

CCCGTTCTTTTCTCCAATTAGAGTTGGATTAAGATTAAGATTTTTGTGGCACGCTTTTCAAACTGCTAAACGGTGTGTTTCGTGCGAAAACTTTCTATAT[G/A]
AAAGTTGTTCTAAAATATCATATTAATCTATTTTTTAAGTTTACAATAATATAGATTCTTCTTACAGTTATACTGTAGATTTTTGCAGCAGATAGGGAGG

Reverse complement sequence

CCTCCCTATCTGCTGCAAAAATCTACAGTATAACTGTAAGAAGAATCTATATTATTGTAAACTTAAAAAATAGATTAATATGATATTTTAGAACAACTTT[C/T]
ATATAGAAAGTTTTCGCACGAAACACACCGTTTAGCAGTTTGAAAAGCGTGCCACAAAAATCTTAATCTTAATCCAACTCTAATTGGAGAAAAGAACGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.00%	21.60%	0.06%	4.32%	NA
All Indica	2759	64.60%	34.10%	0.00%	1.34%	NA
All Japonica	1512	99.90%	0.00%	0.00%	0.07%	NA
Aus	269	11.50%	27.90%	1.12%	59.48%	NA
Indica I	595	78.50%	21.50%	0.00%	0.00%	NA
Indica II	465	88.80%	11.00%	0.00%	0.22%	NA
Indica III	913	42.30%	56.30%	0.00%	1.42%	NA
Indica Intermediate	786	65.60%	31.40%	0.00%	2.93%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	88.90%	6.70%	0.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0705638810	G -> DEL	N	N	silent_mutation	Average:60.172; most accessible tissue: Callus, score: 93.52	N	N	N	N
vg0705638810	G -> A	LOC_Os07g10470.1	upstream_gene_variant ; 4015.0bp to feature; MODIFIER	silent_mutation	Average:60.172; most accessible tissue: Callus, score: 93.52	N	N	N	N
vg0705638810	G -> A	LOC_Os07g10480.1	upstream_gene_variant ; 1656.0bp to feature; MODIFIER	silent_mutation	Average:60.172; most accessible tissue: Callus, score: 93.52	N	N	N	N
vg0705638810	G -> A	LOC_Os07g10470-LOC_Os07g10480	intergenic_region ; MODIFIER	silent_mutation	Average:60.172; most accessible tissue: Callus, score: 93.52	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0705638810	NA	7.19E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	1.38E-08	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	2.46E-06	mr1246	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	6.31E-08	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	6.86E-08	mr1218_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	6.11E-07	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	1.04E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	8.51E-07	mr1318_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	3.31E-06	mr1348_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	1.66E-10	mr1422_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	4.77E-06	mr1567_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	5.24E-08	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	1.65E-06	mr1721_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	2.17E-07	mr1771_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	2.46E-06	mr1788_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	1.50E-07	mr1844_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	1.69E-08	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	1.83E-06	mr1862_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810	NA	3.22E-06	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251