\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705638810:

Variant ID: vg0705638810 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5638810
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


CCCGTTCTTTTCTCCAATTAGAGTTGGATTAAGATTAAGATTTTTGTGGCACGCTTTTCAAACTGCTAAACGGTGTGTTTCGTGCGAAAACTTTCTATAT[G/A]
AAAGTTGTTCTAAAATATCATATTAATCTATTTTTTAAGTTTACAATAATATAGATTCTTCTTACAGTTATACTGTAGATTTTTGCAGCAGATAGGGAGG

Reverse complement sequence

CCTCCCTATCTGCTGCAAAAATCTACAGTATAACTGTAAGAAGAATCTATATTATTGTAAACTTAAAAAATAGATTAATATGATATTTTAGAACAACTTT[C/T]
ATATAGAAAGTTTTCGCACGAAACACACCGTTTAGCAGTTTGAAAAGCGTGCCACAAAAATCTTAATCTTAATCCAACTCTAATTGGAGAAAAGAACGGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.00% 21.60% 0.06% 4.32% NA
All Indica  2759 64.60% 34.10% 0.00% 1.34% NA
All Japonica  1512 99.90% 0.00% 0.00% 0.07% NA
Aus  269 11.50% 27.90% 1.12% 59.48% NA
Indica I  595 78.50% 21.50% 0.00% 0.00% NA
Indica II  465 88.80% 11.00% 0.00% 0.22% NA
Indica III  913 42.30% 56.30% 0.00% 1.42% NA
Indica Intermediate  786 65.60% 31.40% 0.00% 2.93% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.00% 0.41% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 88.90% 6.70% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705638810 G -> DEL N N silent_mutation Average:60.172; most accessible tissue: Callus, score: 93.52 N N N N
vg0705638810 G -> A LOC_Os07g10470.1 upstream_gene_variant ; 4015.0bp to feature; MODIFIER silent_mutation Average:60.172; most accessible tissue: Callus, score: 93.52 N N N N
vg0705638810 G -> A LOC_Os07g10480.1 upstream_gene_variant ; 1656.0bp to feature; MODIFIER silent_mutation Average:60.172; most accessible tissue: Callus, score: 93.52 N N N N
vg0705638810 G -> A LOC_Os07g10470-LOC_Os07g10480 intergenic_region ; MODIFIER silent_mutation Average:60.172; most accessible tissue: Callus, score: 93.52 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705638810 NA 7.19E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 1.38E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 2.46E-06 mr1246 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 6.31E-08 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 6.86E-08 mr1218_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 6.11E-07 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 1.04E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 8.51E-07 mr1318_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 3.31E-06 mr1348_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 1.66E-10 mr1422_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 4.77E-06 mr1567_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 5.24E-08 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 1.65E-06 mr1721_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 2.17E-07 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 2.46E-06 mr1788_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 1.50E-07 mr1844_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 1.69E-08 mr1850_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 1.83E-06 mr1862_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705638810 NA 3.22E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251