\
| Variant ID: vg0705591916 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5591916 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 304. )
CTCTGGAAGAAAGTATTTGCAATAGAGCATATAATACATAGTACCACATTAGGCCTTTCTATGACCAATGTCACAACTTGACATTTGGTGTGCAAGGACA[C/G]
AATCACTCGACAAAAATACGTGGGCATTGACCAAAAAAAACATTTATTGTATTGATAAAAAAATAAAGTTGAACATCTGAGAAGTACACCTAAACCATGA
TCATGGTTTAGGTGTACTTCTCAGATGTTCAACTTTATTTTTTTATCAATACAATAAATGTTTTTTTTGGTCAATGCCCACGTATTTTTGTCGAGTGATT[G/C]
TGTCCTTGCACACCAAATGTCAAGTTGTGACATTGGTCATAGAAAGGCCTAATGTGGTACTATGTATTATATGCTCTATTGCAAATACTTTCTTCCAGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.00% | 6.50% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 79.50% | 19.00% | 1.46% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.20% | 0.65% | 0.00% | NA |
| Tropical Japonica | 504 | 44.00% | 53.00% | 2.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 7.80% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705591916 | C -> G | LOC_Os07g10410.1 | upstream_gene_variant ; 1994.0bp to feature; MODIFIER | silent_mutation | Average:48.021; most accessible tissue: Zhenshan97 root, score: 84.212 | N | N | N | N |
| vg0705591916 | C -> G | LOC_Os07g10400.1 | downstream_gene_variant ; 4373.0bp to feature; MODIFIER | silent_mutation | Average:48.021; most accessible tissue: Zhenshan97 root, score: 84.212 | N | N | N | N |
| vg0705591916 | C -> G | LOC_Os07g10400-LOC_Os07g10410 | intergenic_region ; MODIFIER | silent_mutation | Average:48.021; most accessible tissue: Zhenshan97 root, score: 84.212 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705591916 | 9.50E-07 | NA | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 3.02E-07 | NA | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 7.91E-07 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 1.78E-06 | NA | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 7.95E-06 | NA | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 4.70E-11 | NA | mr1107 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 1.90E-09 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | NA | 3.14E-08 | mr1408 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 7.33E-08 | NA | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | NA | 1.02E-09 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | NA | 2.04E-12 | mr1540 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | NA | 3.53E-13 | mr1732 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | NA | 4.11E-06 | mr1742 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 9.51E-06 | NA | mr1949 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 1.03E-13 | NA | mr1082_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 3.05E-14 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | NA | 7.23E-06 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 3.34E-09 | NA | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 1.36E-06 | NA | mr1088_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 9.50E-11 | NA | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 2.85E-12 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 3.84E-11 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 1.56E-06 | NA | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 2.89E-06 | NA | mr1155_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 1.48E-12 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 2.85E-07 | NA | mr1264_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 7.15E-08 | 2.38E-13 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 2.74E-07 | NA | mr1437_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705591916 | 8.50E-06 | NA | mr1949_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |