\
| Variant ID: vg0705549134 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5549134 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GCCGGCCACCGAGCGAGTTGAGGATGACCCTGACCGCGCCCCTCAGCCCTCCGCCTTGAGCTCGAGCGTCGGCTCTGCCAGGACGGCCCGCCTTTGCTGC[C/T]
GCCTTTCTCGCCTTGACGCCTGCTGCTGCCTCGCTGACGCAGGACCTGGAGTTGCCGTCACCCTCCGTGCCCTCTGCTGCTGCTGCCGCTGCCGCTACAC
GTGTAGCGGCAGCGGCAGCAGCAGCAGAGGGCACGGAGGGTGACGGCAACTCCAGGTCCTGCGTCAGCGAGGCAGCAGCAGGCGTCAAGGCGAGAAAGGC[G/A]
GCAGCAAAGGCGGGCCGTCCTGGCAGAGCCGACGCTCGAGCTCAAGGCGGAGGGCTGAGGGGCGCGGTCAGGGTCATCCTCAACTCGCTCGGTGGCCGGC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.10% | 40.70% | 0.02% | 0.23% | NA |
| All Indica | 2759 | 90.20% | 9.40% | 0.04% | 0.40% | NA |
| All Japonica | 1512 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 88.00% | 11.40% | 0.00% | 0.65% | NA |
| Indica III | 913 | 84.70% | 14.60% | 0.00% | 0.77% | NA |
| Indica Intermediate | 786 | 90.60% | 9.20% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 4.20% | 95.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 58.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705549134 | C -> DEL | N | N | silent_mutation | Average:71.815; most accessible tissue: Zhenshan97 young leaf, score: 88.127 | N | N | N | N |
| vg0705549134 | C -> T | LOC_Os07g10350.1 | upstream_gene_variant ; 2451.0bp to feature; MODIFIER | silent_mutation | Average:71.815; most accessible tissue: Zhenshan97 young leaf, score: 88.127 | N | N | N | N |
| vg0705549134 | C -> T | LOC_Os07g10340-LOC_Os07g10350 | intergenic_region ; MODIFIER | silent_mutation | Average:71.815; most accessible tissue: Zhenshan97 young leaf, score: 88.127 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705549134 | NA | 8.60E-13 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 2.01E-31 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 3.14E-33 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.30E-19 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 4.35E-45 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 3.14E-07 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 3.52E-26 | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 3.97E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.92E-32 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 2.53E-11 | mr1325 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 4.28E-13 | mr1326 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.75E-14 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 5.88E-11 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 3.73E-52 | mr1795 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.25E-15 | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 3.18E-60 | mr1861 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 4.67E-07 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 8.23E-15 | mr1933 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 9.54E-66 | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 3.88E-59 | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.05E-45 | mr1072_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.99E-08 | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.64E-45 | mr1075_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 2.34E-08 | mr1075_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 6.96E-26 | mr1077_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.70E-33 | mr1085_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 2.60E-64 | mr1124_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 4.03E-09 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 5.09E-33 | mr1149_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 9.53E-09 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 7.68E-36 | mr1155_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 2.57E-17 | mr1199_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 9.55E-13 | mr1216_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 5.99E-08 | mr1299_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.46E-15 | mr1324_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.38E-12 | mr1325_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 4.47E-14 | mr1326_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.69E-16 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.20E-16 | mr1342_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.59E-64 | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 8.30E-08 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 9.80E-33 | mr1441_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.07E-08 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.13E-10 | mr1537_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 8.54E-22 | mr1592_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 4.65E-06 | mr1592_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.15E-11 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.49E-11 | mr1600_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 2.28E-24 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 2.32E-19 | mr1637_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 8.62E-15 | mr1686_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 5.79E-08 | mr1700_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 3.13E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 7.58E-07 | mr1727_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 2.26E-06 | mr1754_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 9.93E-09 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 3.27E-91 | mr1795_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 9.80E-08 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.48E-07 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 2.83E-53 | mr1861_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 4.39E-38 | mr1888_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 1.08E-31 | mr1891_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 7.45E-08 | mr1915_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 8.88E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705549134 | NA | 5.62E-121 | mr1962_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |