Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705527867:

Variant ID: vg0705527867 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 5527867
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:

TAGTGAAACAATTCCGATATACCTAGTTGAACATCGTGCAACATTCAAAAATAATTCAATAATAAGCTAAAAAAAATTCGTAGGAATATATCCATGTGTG[A/G]
TCTTGTTTTGAAGATTTAATTGCAACGAATTTAATGGTACAATCGAATAATAATTTGGATAAGTAATTTGAGAGATAAATCAGTTTAAAGTAATTTTACA

Reverse complement sequence

TGTAAAATTACTTTAAACTGATTTATCTCTCAAATTACTTATCCAAATTATTATTCGATTGTACCATTAAATTCGTTGCAATTAAATCTTCAAAACAAGA[T/C]
CACACATGGATATATTCCTACGAATTTTTTTTAGCTTATTATTGAATTATTTTTGAATGTTGCACGATGTTCAACTAGGTATATCGGAATTGTTTCACTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.70%	1.40%	1.46%	60.41%	NA
All Indica	2759	3.60%	1.30%	2.21%	92.86%	NA
All Japonica	1512	98.00%	1.70%	0.00%	0.33%	NA
Aus	269	5.20%	0.40%	2.23%	92.19%	NA
Indica I	595	1.80%	1.20%	2.02%	94.96%	NA
Indica II	465	4.70%	1.10%	2.15%	92.04%	NA
Indica III	913	4.60%	0.80%	2.19%	92.44%	NA
Indica Intermediate	786	3.20%	2.20%	2.42%	92.24%	NA
Temperate Japonica	767	97.70%	2.20%	0.00%	0.13%	NA
Tropical Japonica	504	99.60%	0.00%	0.00%	0.40%	NA
Japonica Intermediate	241	95.90%	3.30%	0.00%	0.83%	NA
VI/Aromatic	96	93.80%	0.00%	0.00%	6.25%	NA
Intermediate	90	55.60%	4.40%	2.22%	37.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0705527867	A -> DEL	N	N	silent_mutation	Average:29.526; most accessible tissue: Callus, score: 54.816	N	N	N	N
vg0705527867	A -> G	LOC_Os07g10320.1	upstream_gene_variant ; 2786.0bp to feature; MODIFIER	silent_mutation	Average:29.526; most accessible tissue: Callus, score: 54.816	N	N	N	N
vg0705527867	A -> G	LOC_Os07g10300.1	downstream_gene_variant ; 1169.0bp to feature; MODIFIER	silent_mutation	Average:29.526; most accessible tissue: Callus, score: 54.816	N	N	N	N
vg0705527867	A -> G	LOC_Os07g10310.1	downstream_gene_variant ; 386.0bp to feature; MODIFIER	silent_mutation	Average:29.526; most accessible tissue: Callus, score: 54.816	N	N	N	N
vg0705527867	A -> G	LOC_Os07g10300.2	downstream_gene_variant ; 1169.0bp to feature; MODIFIER	silent_mutation	Average:29.526; most accessible tissue: Callus, score: 54.816	N	N	N	N
vg0705527867	A -> G	LOC_Os07g10300.3	downstream_gene_variant ; 1169.0bp to feature; MODIFIER	silent_mutation	Average:29.526; most accessible tissue: Callus, score: 54.816	N	N	N	N
vg0705527867	A -> G	LOC_Os07g10300-LOC_Os07g10310	intergenic_region ; MODIFIER	silent_mutation	Average:29.526; most accessible tissue: Callus, score: 54.816	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0705527867	NA	2.16E-27	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867	NA	2.16E-28	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867	NA	1.41E-06	mr1082	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867	NA	6.99E-13	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867	NA	2.17E-10	mr1301	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867	NA	4.02E-07	mr1410	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867	NA	2.39E-13	mr1441	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867	NA	4.97E-06	mr1560	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867	NA	1.62E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867	NA	5.33E-36	mr1155_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867	NA	1.54E-07	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867	NA	1.90E-14	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867	NA	5.12E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251