\
| Variant ID: vg0705527867 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5527867 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 82. )
TAGTGAAACAATTCCGATATACCTAGTTGAACATCGTGCAACATTCAAAAATAATTCAATAATAAGCTAAAAAAAATTCGTAGGAATATATCCATGTGTG[A/G]
TCTTGTTTTGAAGATTTAATTGCAACGAATTTAATGGTACAATCGAATAATAATTTGGATAAGTAATTTGAGAGATAAATCAGTTTAAAGTAATTTTACA
TGTAAAATTACTTTAAACTGATTTATCTCTCAAATTACTTATCCAAATTATTATTCGATTGTACCATTAAATTCGTTGCAATTAAATCTTCAAAACAAGA[T/C]
CACACATGGATATATTCCTACGAATTTTTTTTAGCTTATTATTGAATTATTTTTGAATGTTGCACGATGTTCAACTAGGTATATCGGAATTGTTTCACTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.70% | 1.40% | 1.46% | 60.41% | NA |
| All Indica | 2759 | 3.60% | 1.30% | 2.21% | 92.86% | NA |
| All Japonica | 1512 | 98.00% | 1.70% | 0.00% | 0.33% | NA |
| Aus | 269 | 5.20% | 0.40% | 2.23% | 92.19% | NA |
| Indica I | 595 | 1.80% | 1.20% | 2.02% | 94.96% | NA |
| Indica II | 465 | 4.70% | 1.10% | 2.15% | 92.04% | NA |
| Indica III | 913 | 4.60% | 0.80% | 2.19% | 92.44% | NA |
| Indica Intermediate | 786 | 3.20% | 2.20% | 2.42% | 92.24% | NA |
| Temperate Japonica | 767 | 97.70% | 2.20% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 95.90% | 3.30% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 55.60% | 4.40% | 2.22% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705527867 | A -> DEL | N | N | silent_mutation | Average:29.526; most accessible tissue: Callus, score: 54.816 | N | N | N | N |
| vg0705527867 | A -> G | LOC_Os07g10320.1 | upstream_gene_variant ; 2786.0bp to feature; MODIFIER | silent_mutation | Average:29.526; most accessible tissue: Callus, score: 54.816 | N | N | N | N |
| vg0705527867 | A -> G | LOC_Os07g10300.1 | downstream_gene_variant ; 1169.0bp to feature; MODIFIER | silent_mutation | Average:29.526; most accessible tissue: Callus, score: 54.816 | N | N | N | N |
| vg0705527867 | A -> G | LOC_Os07g10310.1 | downstream_gene_variant ; 386.0bp to feature; MODIFIER | silent_mutation | Average:29.526; most accessible tissue: Callus, score: 54.816 | N | N | N | N |
| vg0705527867 | A -> G | LOC_Os07g10300.2 | downstream_gene_variant ; 1169.0bp to feature; MODIFIER | silent_mutation | Average:29.526; most accessible tissue: Callus, score: 54.816 | N | N | N | N |
| vg0705527867 | A -> G | LOC_Os07g10300.3 | downstream_gene_variant ; 1169.0bp to feature; MODIFIER | silent_mutation | Average:29.526; most accessible tissue: Callus, score: 54.816 | N | N | N | N |
| vg0705527867 | A -> G | LOC_Os07g10300-LOC_Os07g10310 | intergenic_region ; MODIFIER | silent_mutation | Average:29.526; most accessible tissue: Callus, score: 54.816 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705527867 | NA | 2.16E-27 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705527867 | NA | 2.16E-28 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705527867 | NA | 1.41E-06 | mr1082 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705527867 | NA | 6.99E-13 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705527867 | NA | 2.17E-10 | mr1301 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705527867 | NA | 4.02E-07 | mr1410 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705527867 | NA | 2.39E-13 | mr1441 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705527867 | NA | 4.97E-06 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705527867 | NA | 1.62E-13 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705527867 | NA | 5.33E-36 | mr1155_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705527867 | NA | 1.54E-07 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705527867 | NA | 1.90E-14 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705527867 | NA | 5.12E-07 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |