\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705527867:

Variant ID: vg0705527867 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5527867
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


TAGTGAAACAATTCCGATATACCTAGTTGAACATCGTGCAACATTCAAAAATAATTCAATAATAAGCTAAAAAAAATTCGTAGGAATATATCCATGTGTG[A/G]
TCTTGTTTTGAAGATTTAATTGCAACGAATTTAATGGTACAATCGAATAATAATTTGGATAAGTAATTTGAGAGATAAATCAGTTTAAAGTAATTTTACA

Reverse complement sequence

TGTAAAATTACTTTAAACTGATTTATCTCTCAAATTACTTATCCAAATTATTATTCGATTGTACCATTAAATTCGTTGCAATTAAATCTTCAAAACAAGA[T/C]
CACACATGGATATATTCCTACGAATTTTTTTTAGCTTATTATTGAATTATTTTTGAATGTTGCACGATGTTCAACTAGGTATATCGGAATTGTTTCACTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.70% 1.40% 1.46% 60.41% NA
All Indica  2759 3.60% 1.30% 2.21% 92.86% NA
All Japonica  1512 98.00% 1.70% 0.00% 0.33% NA
Aus  269 5.20% 0.40% 2.23% 92.19% NA
Indica I  595 1.80% 1.20% 2.02% 94.96% NA
Indica II  465 4.70% 1.10% 2.15% 92.04% NA
Indica III  913 4.60% 0.80% 2.19% 92.44% NA
Indica Intermediate  786 3.20% 2.20% 2.42% 92.24% NA
Temperate Japonica  767 97.70% 2.20% 0.00% 0.13% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 95.90% 3.30% 0.00% 0.83% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 55.60% 4.40% 2.22% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705527867 A -> DEL N N silent_mutation Average:29.526; most accessible tissue: Callus, score: 54.816 N N N N
vg0705527867 A -> G LOC_Os07g10320.1 upstream_gene_variant ; 2786.0bp to feature; MODIFIER silent_mutation Average:29.526; most accessible tissue: Callus, score: 54.816 N N N N
vg0705527867 A -> G LOC_Os07g10300.1 downstream_gene_variant ; 1169.0bp to feature; MODIFIER silent_mutation Average:29.526; most accessible tissue: Callus, score: 54.816 N N N N
vg0705527867 A -> G LOC_Os07g10310.1 downstream_gene_variant ; 386.0bp to feature; MODIFIER silent_mutation Average:29.526; most accessible tissue: Callus, score: 54.816 N N N N
vg0705527867 A -> G LOC_Os07g10300.2 downstream_gene_variant ; 1169.0bp to feature; MODIFIER silent_mutation Average:29.526; most accessible tissue: Callus, score: 54.816 N N N N
vg0705527867 A -> G LOC_Os07g10300.3 downstream_gene_variant ; 1169.0bp to feature; MODIFIER silent_mutation Average:29.526; most accessible tissue: Callus, score: 54.816 N N N N
vg0705527867 A -> G LOC_Os07g10300-LOC_Os07g10310 intergenic_region ; MODIFIER silent_mutation Average:29.526; most accessible tissue: Callus, score: 54.816 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705527867 NA 2.16E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867 NA 2.16E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867 NA 1.41E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867 NA 6.99E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867 NA 2.17E-10 mr1301 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867 NA 4.02E-07 mr1410 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867 NA 2.39E-13 mr1441 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867 NA 4.97E-06 mr1560 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867 NA 1.62E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867 NA 5.33E-36 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867 NA 1.54E-07 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867 NA 1.90E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705527867 NA 5.12E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251