\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705521102:

Variant ID: vg0705521102 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5521102
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACAAGCCACGTAGGCGCTACATCAGCCAAAACTGCCTTCAAAACCGCCGAGGGACCTTGTTTGCCCGGTTTTCGTAAATTGGGGGACGGGTCGTACCC[G/A]
GTTTTGCGGTCAAGGGACGAGACGAAAATCGGACTGGACGAGAAATAGAGGGACCCAAAGTGAACTTATTCCTTAAAAAAAATCGATAGAGACAGACAAG

Reverse complement sequence

CTTGTCTGTCTCTATCGATTTTTTTTAAGGAATAAGTTCACTTTGGGTCCCTCTATTTCTCGTCCAGTCCGATTTTCGTCTCGTCCCTTGACCGCAAAAC[C/T]
GGGTACGACCCGTCCCCCAATTTACGAAAACCGGGCAAACAAGGTCCCTCGGCGGTTTTGAAGGCAGTTTTGGCTGATGTAGCGCCTACGTGGCTTGTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.20% 33.70% 16.06% 13.01% NA
All Indica  2759 3.30% 56.00% 20.66% 19.97% NA
All Japonica  1512 99.70% 0.10% 0.20% 0.00% NA
Aus  269 5.90% 10.00% 63.57% 20.45% NA
Indica I  595 0.50% 62.40% 20.84% 16.30% NA
Indica II  465 3.70% 48.20% 18.28% 29.89% NA
Indica III  913 5.30% 58.60% 20.37% 15.77% NA
Indica Intermediate  786 3.10% 52.90% 22.26% 21.76% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 93.80% 0.00% 6.25% 0.00% NA
Intermediate  90 57.80% 22.20% 10.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705521102 G -> DEL N N silent_mutation Average:97.171; most accessible tissue: Zhenshan97 panicle, score: 98.886 N N N N
vg0705521102 G -> A LOC_Os07g10290.1 upstream_gene_variant ; 1145.0bp to feature; MODIFIER silent_mutation Average:97.171; most accessible tissue: Zhenshan97 panicle, score: 98.886 N N N N
vg0705521102 G -> A LOC_Os07g10300.1 upstream_gene_variant ; 507.0bp to feature; MODIFIER silent_mutation Average:97.171; most accessible tissue: Zhenshan97 panicle, score: 98.886 N N N N
vg0705521102 G -> A LOC_Os07g10300.2 upstream_gene_variant ; 507.0bp to feature; MODIFIER silent_mutation Average:97.171; most accessible tissue: Zhenshan97 panicle, score: 98.886 N N N N
vg0705521102 G -> A LOC_Os07g10300.3 upstream_gene_variant ; 507.0bp to feature; MODIFIER silent_mutation Average:97.171; most accessible tissue: Zhenshan97 panicle, score: 98.886 N N N N
vg0705521102 G -> A LOC_Os07g10290-LOC_Os07g10300 intergenic_region ; MODIFIER silent_mutation Average:97.171; most accessible tissue: Zhenshan97 panicle, score: 98.886 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0705521102 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705521102 NA 2.13E-43 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 2.79E-25 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 3.30E-20 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 1.17E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 2.29E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 3.51E-27 mr1145 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 1.31E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 2.87E-32 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 8.45E-13 mr1362 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 1.07E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 8.85E-15 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 1.62E-11 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 6.26E-16 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 3.29E-13 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 2.71E-08 mr1770 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 3.62E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 2.51E-07 2.51E-07 mr1955 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 8.46E-59 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 7.31E-08 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 1.10E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 3.68E-32 mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 1.48E-73 mr1088_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 3.15E-08 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 2.32E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 1.54E-17 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 6.79E-57 mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 8.13E-13 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 8.73E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 2.73E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 4.21E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 1.55E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705521102 NA 3.70E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251