\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705451627:

Variant ID: vg0705451627 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5451627
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCTTTTATAGGCATTCAACGAGTAGATCTCTAACCAGACGACAACAAACTTTCGGCGGACAGGCAAACAACAAATGAAAAAGGCTGGGACTAGAGAAG[G/A]
GAATCACTCTCTCCTTTGTTTCTAGCTGAGCATGTCACATGGAGTGAGAGGACAAAGAACTTTTGGTGGACAAAACAACGTTCGGTGTGGTCTCGCGGAA

Reverse complement sequence

TTCCGCGAGACCACACCGAACGTTGTTTTGTCCACCAAAAGTTCTTTGTCCTCTCACTCCATGTGACATGCTCAGCTAGAAACAAAGGAGAGAGTGATTC[C/T]
CTTCTCTAGTCCCAGCCTTTTTCATTTGTTGTTTGCCTGTCCGCCGAAAGTTTGTTGTCGTCTGGTTAGAGATCTACTCGTTGAATGCCTATAAAAGAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 6.50% 0.04% 0.00% NA
All Indica  2759 98.00% 2.00% 0.07% 0.00% NA
All Japonica  1512 96.60% 3.40% 0.00% 0.00% NA
Aus  269 27.50% 72.50% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 97.00% 3.00% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.30% 0.25% 0.00% NA
Temperate Japonica  767 94.70% 5.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.90% 4.10% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705451627 G -> A LOC_Os07g10150.1 upstream_gene_variant ; 542.0bp to feature; MODIFIER silent_mutation Average:66.769; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0705451627 G -> A LOC_Os07g10139.1 downstream_gene_variant ; 1052.0bp to feature; MODIFIER silent_mutation Average:66.769; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N
vg0705451627 G -> A LOC_Os07g10139-LOC_Os07g10150 intergenic_region ; MODIFIER silent_mutation Average:66.769; most accessible tissue: Zhenshan97 panicle, score: 76.605 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705451627 NA 4.45E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705451627 NA 5.78E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705451627 NA 6.71E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705451627 1.25E-16 3.41E-70 mr1549 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705451627 2.20E-20 3.42E-80 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705451627 NA 6.67E-08 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705451627 3.39E-23 1.52E-79 mr1757 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705451627 NA 4.34E-08 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705451627 NA 2.55E-07 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705451627 NA 3.04E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705451627 NA 1.37E-08 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705451627 1.52E-27 3.41E-72 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705451627 2.99E-22 1.79E-87 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705451627 1.05E-20 2.11E-60 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705451627 NA 7.60E-08 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251