Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705345844:

Variant ID: vg0705345844 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 5345844
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCTTCACGTACACGGATCGTTCCCGTGAATATCGTTTGGAATCCATCGCAAATTATGAAAAATATCTCTACAAGTCAAGCGATTTCCAAAGTCCTACTC[G/A]
GAAGGGATAGAGTTTCTATTATGCCATACCAGATCAAATACCCTTAGATCTTTCTTGGGGGTCAAGATGATCCACGCTATAAAAGGGACCCCTGGGAGGG

Reverse complement sequence

CCCTCCCAGGGGTCCCTTTTATAGCGTGGATCATCTTGACCCCCAAGAAAGATCTAAGGGTATTTGATCTGGTATGGCATAATAGAAACTCTATCCCTTC[C/T]
GAGTAGGACTTTGGAAATCGCTTGACTTGTAGAGATATTTTTCATAATTTGCGATGGATTCCAAACGATATTCACGGGAACGATCCGTGTACGTGAAGGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.80%	38.70%	0.76%	0.78%	NA
All Indica	2759	91.00%	8.50%	0.07%	0.40%	NA
All Japonica	1512	0.50%	95.60%	2.25%	1.65%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	92.00%	7.10%	0.00%	0.86%	NA
Indica III	913	85.50%	13.70%	0.11%	0.66%	NA
Indica Intermediate	786	90.20%	9.50%	0.13%	0.13%	NA
Temperate Japonica	767	0.30%	95.80%	3.13%	0.78%	NA
Tropical Japonica	504	0.40%	95.20%	0.99%	3.37%	NA
Japonica Intermediate	241	1.70%	95.40%	2.07%	0.83%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	40.00%	58.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0705345844	G -> DEL	N	N	silent_mutation	Average:42.985; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0705345844	G -> A	LOC_Os07g10020.1	upstream_gene_variant ; 986.0bp to feature; MODIFIER	silent_mutation	Average:42.985; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0705345844	G -> A	LOC_Os07g10000.1	downstream_gene_variant ; 4640.0bp to feature; MODIFIER	silent_mutation	Average:42.985; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0705345844	G -> A	LOC_Os07g10010.1	downstream_gene_variant ; 726.0bp to feature; MODIFIER	silent_mutation	Average:42.985; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0705345844	G -> A	LOC_Os07g10030.1	downstream_gene_variant ; 3062.0bp to feature; MODIFIER	silent_mutation	Average:42.985; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0705345844	G -> A	LOC_Os07g10010-LOC_Os07g10020	intergenic_region ; MODIFIER	silent_mutation	Average:42.985; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0705345844	NA	1.20E-28	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.06E-29	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	2.82E-34	mr1081	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.85E-42	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.06E-06	mr1124	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	5.31E-26	mr1130	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	2.11E-27	mr1148	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	5.82E-22	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	2.92E-44	mr1152	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	2.51E-31	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	7.18E-11	mr1325	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	2.38E-13	mr1441	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.52E-14	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.31E-10	mr1623	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	9.09E-08	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.38E-16	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	7.19E-60	mr1861	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	6.08E-07	mr1861	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	7.95E-13	mr1924	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	5.58E-07	5.58E-07	mr1955	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.13E-65	mr1962	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.60E-43	mr1072_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.50E-08	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.59E-42	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	6.22E-08	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.78E-24	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	4.29E-62	mr1124_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	5.83E-09	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.23E-30	mr1149_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	2.41E-08	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.55E-31	mr1150_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.54E-14	mr1333_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	5.79E-07	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	4.40E-31	mr1441_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.23E-08	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	3.58E-19	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.02E-09	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	2.90E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.02E-15	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.66E-55	mr1861_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	3.21E-34	mr1888_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	5.66E-31	mr1891_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705345844	NA	1.18E-120	mr1962_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251