\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705313365:

Variant ID: vg0705313365 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5313365
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTCCAAAAAAACTCAACTTCCAGAGTTTAAATTTTGTCCCACAAAAACCTACTCTCAGCACATAAAACGAGATGTTTTATTTCTTAAATACACTTTACC[T/A]
ACCTATCACTGTTACTACTTTTTTCAATAATGAGGAGTATTTTGGTCATTTTTACTCTCCACTAATTTCTTCTTGGGATCCTAGAAATTGCTAATATAAG

Reverse complement sequence

CTTATATTAGCAATTTCTAGGATCCCAAGAAGAAATTAGTGGAGAGTAAAAATGACCAAAATACTCCTCATTATTGAAAAAAGTAGTAACAGTGATAGGT[A/T]
GGTAAAGTGTATTTAAGAAATAAAACATCTCGTTTTATGTGCTGAGAGTAGGTTTTTGTGGGACAAAATTTAAACTCTGGAAGTTGAGTTTTTTTGGACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 40.00% 0.13% 0.04% NA
All Indica  2759 91.10% 8.60% 0.22% 0.07% NA
All Japonica  1512 0.40% 99.60% 0.00% 0.00% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 92.50% 7.10% 0.43% 0.00% NA
Indica III  913 85.80% 13.80% 0.33% 0.11% NA
Indica Intermediate  786 90.30% 9.40% 0.13% 0.13% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 40.00% 60.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705313365 T -> DEL N N silent_mutation Average:60.959; most accessible tissue: Zhenshan97 flower, score: 76.751 N N N N
vg0705313365 T -> A LOC_Os07g09970.1 upstream_gene_variant ; 423.0bp to feature; MODIFIER silent_mutation Average:60.959; most accessible tissue: Zhenshan97 flower, score: 76.751 N N N N
vg0705313365 T -> A LOC_Os07g09960-LOC_Os07g09970 intergenic_region ; MODIFIER silent_mutation Average:60.959; most accessible tissue: Zhenshan97 flower, score: 76.751 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705313365 1.45E-06 1.92E-07 mr1047 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.64E-11 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.16E-28 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.15E-29 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 6.86E-34 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 5.88E-42 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 4.11E-06 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 2.45E-14 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.34E-27 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 8.28E-23 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.87E-43 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.38E-30 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.58E-15 mr1324 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.46E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 6.85E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 6.75E-30 mr1333 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 3.63E-13 mr1335 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 2.43E-06 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 3.80E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 2.51E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 3.88E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 3.87E-06 mr1678 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 7.96E-26 mr1686 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 6.48E-06 mr1734 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 7.65E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.04E-58 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 2.17E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 4.02E-64 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.49E-42 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 7.24E-26 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 7.21E-42 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 3.56E-61 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.05E-30 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.76E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 3.69E-32 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 9.48E-19 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 4.00E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 2.62E-31 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.01E-07 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 2.62E-18 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.62E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 3.48E-16 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 1.59E-54 mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 3.42E-30 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705313365 NA 8.60E-120 mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251