\
| Variant ID: vg0705311222 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5311222 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )
TATTTCTCCTCAAATTCCTATGTTTTTCCTGTGGACCAATCAAACGGTCATTCCTATGTTATCCCTGTGTTTTACAATCCTCTGTTTTATACTTACATTT[C/A]
TGTCAGAATCCTATGTTTTTCCTATTCCTCCGTTTTTTCATTTCTGTGATTCAAAGGGGCCCTTAAACCACTTGTTGCAAGTCACTCCAAATTGGCCTCA
TGAGGCCAATTTGGAGTGACTTGCAACAAGTGGTTTAAGGGCCCCTTTGAATCACAGAAATGAAAAAACGGAGGAATAGGAAAAACATAGGATTCTGACA[G/T]
AAATGTAAGTATAAAACAGAGGATTGTAAAACACAGGGATAACATAGGAATGACCGTTTGATTGGTCCACAGGAAAAACATAGGAATTTGAGGAGAAATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.50% | 6.60% | 1.82% | 2.05% | NA |
| All Indica | 2759 | 94.10% | 0.40% | 1.99% | 3.52% | NA |
| All Japonica | 1512 | 78.60% | 19.40% | 1.98% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 94.60% | 1.50% | 2.15% | 1.72% | NA |
| Indica III | 913 | 90.40% | 0.00% | 3.29% | 6.35% | NA |
| Indica Intermediate | 786 | 93.80% | 0.40% | 1.91% | 3.94% | NA |
| Temperate Japonica | 767 | 97.50% | 1.00% | 1.43% | 0.00% | NA |
| Tropical Japonica | 504 | 42.30% | 54.40% | 3.37% | 0.00% | NA |
| Japonica Intermediate | 241 | 94.20% | 5.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705311222 | C -> DEL | N | N | silent_mutation | Average:48.432; most accessible tissue: Callus, score: 73.574 | N | N | N | N |
| vg0705311222 | C -> A | LOC_Os07g09960.1 | upstream_gene_variant ; 3507.0bp to feature; MODIFIER | silent_mutation | Average:48.432; most accessible tissue: Callus, score: 73.574 | N | N | N | N |
| vg0705311222 | C -> A | LOC_Os07g09970.1 | upstream_gene_variant ; 2566.0bp to feature; MODIFIER | silent_mutation | Average:48.432; most accessible tissue: Callus, score: 73.574 | N | N | N | N |
| vg0705311222 | C -> A | LOC_Os07g09960-LOC_Os07g09970 | intergenic_region ; MODIFIER | silent_mutation | Average:48.432; most accessible tissue: Callus, score: 73.574 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705311222 | 2.06E-06 | NA | mr1081 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705311222 | 2.88E-06 | 2.88E-06 | mr1254 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705311222 | NA | 4.74E-06 | mr1425 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705311222 | NA | 7.04E-10 | mr1539 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705311222 | NA | 6.85E-07 | mr1742 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705311222 | 1.58E-06 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705311222 | NA | 1.85E-10 | mr1408_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705311222 | NA | 3.59E-15 | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705311222 | NA | 3.98E-07 | mr1819_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705311222 | NA | 5.03E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |