Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705311222:

Variant ID: vg0705311222 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 5311222
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTCTCCTCAAATTCCTATGTTTTTCCTGTGGACCAATCAAACGGTCATTCCTATGTTATCCCTGTGTTTTACAATCCTCTGTTTTATACTTACATTT[C/A]
TGTCAGAATCCTATGTTTTTCCTATTCCTCCGTTTTTTCATTTCTGTGATTCAAAGGGGCCCTTAAACCACTTGTTGCAAGTCACTCCAAATTGGCCTCA

Reverse complement sequence

TGAGGCCAATTTGGAGTGACTTGCAACAAGTGGTTTAAGGGCCCCTTTGAATCACAGAAATGAAAAAACGGAGGAATAGGAAAAACATAGGATTCTGACA[G/T]
AAATGTAAGTATAAAACAGAGGATTGTAAAACACAGGGATAACATAGGAATGACCGTTTGATTGGTCCACAGGAAAAACATAGGAATTTGAGGAGAAATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.50%	6.60%	1.82%	2.05%	NA
All Indica	2759	94.10%	0.40%	1.99%	3.52%	NA
All Japonica	1512	78.60%	19.40%	1.98%	0.00%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	94.60%	1.50%	2.15%	1.72%	NA
Indica III	913	90.40%	0.00%	3.29%	6.35%	NA
Indica Intermediate	786	93.80%	0.40%	1.91%	3.94%	NA
Temperate Japonica	767	97.50%	1.00%	1.43%	0.00%	NA
Tropical Japonica	504	42.30%	54.40%	3.37%	0.00%	NA
Japonica Intermediate	241	94.20%	5.00%	0.83%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0705311222	C -> DEL	N	N	silent_mutation	Average:48.432; most accessible tissue: Callus, score: 73.574	N	N	N	N
vg0705311222	C -> A	LOC_Os07g09960.1	upstream_gene_variant ; 3507.0bp to feature; MODIFIER	silent_mutation	Average:48.432; most accessible tissue: Callus, score: 73.574	N	N	N	N
vg0705311222	C -> A	LOC_Os07g09970.1	upstream_gene_variant ; 2566.0bp to feature; MODIFIER	silent_mutation	Average:48.432; most accessible tissue: Callus, score: 73.574	N	N	N	N
vg0705311222	C -> A	LOC_Os07g09960-LOC_Os07g09970	intergenic_region ; MODIFIER	silent_mutation	Average:48.432; most accessible tissue: Callus, score: 73.574	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0705311222	2.06E-06	NA	mr1081	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705311222	2.88E-06	2.88E-06	mr1254	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705311222	NA	4.74E-06	mr1425	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705311222	NA	7.04E-10	mr1539	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705311222	NA	6.85E-07	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705311222	1.58E-06	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705311222	NA	1.85E-10	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705311222	NA	3.59E-15	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705311222	NA	3.98E-07	mr1819_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705311222	NA	5.03E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251