\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705306490:

Variant ID: vg0705306490 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 5306490
Reference Allele: GTAGCAlternative Allele: ATAGC,G
Primary Allele: GTAGCSecondary Allele: ATAGC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCAGCAAGCCGAGTCCCCCCGGCATCCATCCAGGGGTGGGCTTCTTGCAAGATGGAAAGAGAAGATGGTGTTAAAAAACCTAACCTAAAATCGACATCG[GTAGC/ATAGC,G]
TAAACGCGGAAGAAACGCCAATCCTCACTCATAAGATTAGTCTTTTAGGTTGTATAGGCTCAGGATCTAAAGTTGTGGCTCCGAATGAGCCTGTGGTGAA

Reverse complement sequence

TTCACCACAGGCTCATTCGGAGCCACAACTTTAGATCCTGAGCCTATACAACCTAAAAGACTAATCTTATGAGTGAGGATTGGCGTTTCTTCCGCGTTTA[GCTAC/GCTAT,C]
CGATGTCGATTTTAGGTTAGGTTTTTTAACACCATCTTCTCTTTCCATCTTGCAAGAAGCCCACCCCTGGATGGATGCCGGGGGGACTCGGCTTGCTGCT

Allele Frequencies:

Populations Population SizeFrequency of GTAGC(primary allele) Frequency of ATAGC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.40% 4.90% 0.25% 54.25% G: 0.13%
All Indica  2759 9.50% 4.30% 0.33% 85.86% NA
All Japonica  1512 99.40% 0.10% 0.20% 0.33% NA
Aus  269 2.20% 41.30% 0.00% 56.51% NA
Indica I  595 0.80% 3.50% 0.17% 95.46% NA
Indica II  465 8.00% 3.20% 0.22% 88.60% NA
Indica III  913 15.40% 4.70% 0.22% 79.63% NA
Indica Intermediate  786 10.20% 5.00% 0.64% 84.22% NA
Temperate Japonica  767 99.50% 0.00% 0.39% 0.13% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 98.80% 0.40% 0.00% 0.83% NA
VI/Aromatic  96 87.50% 0.00% 0.00% 6.25% G: 6.25%
Intermediate  90 61.10% 3.30% 0.00% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705306490 GTAGC -> DEL N N silent_mutation Average:80.926; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg0705306490 GTAGC -> ATAGC LOC_Os07g09950.1 upstream_gene_variant ; 1737.0bp to feature; MODIFIER silent_mutation Average:80.926; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg0705306490 GTAGC -> ATAGC LOC_Os07g09960.1 downstream_gene_variant ; 836.0bp to feature; MODIFIER silent_mutation Average:80.926; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg0705306490 GTAGC -> ATAGC LOC_Os07g09950-LOC_Os07g09960 intergenic_region ; MODIFIER silent_mutation Average:80.926; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg0705306490 GTAGC -> G LOC_Os07g09950.1 upstream_gene_variant ; 1738.0bp to feature; MODIFIER silent_mutation Average:80.926; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg0705306490 GTAGC -> G LOC_Os07g09960.1 downstream_gene_variant ; 835.0bp to feature; MODIFIER silent_mutation Average:80.926; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N
vg0705306490 GTAGC -> G LOC_Os07g09950-LOC_Os07g09960 intergenic_region ; MODIFIER silent_mutation Average:80.926; most accessible tissue: Zhenshan97 panicle, score: 92.66 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0705306490 GTAGC ATAGC 0.03 0.03 0.02 0.0 0.02 0.03
vg0705306490 GTAGC G 0.1 0.24 0.28 0.24 0.2 0.21

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705306490 NA 8.85E-13 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 1.36E-31 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 5.31E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 1.32E-30 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 1.66E-32 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 3.11E-20 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 6.58E-33 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 2.68E-45 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 1.52E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 1.32E-25 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 3.41E-27 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 8.37E-22 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 2.48E-46 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 3.56E-33 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 5.54E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 1.72E-14 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 8.65E-16 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 2.83E-53 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 1.86E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 2.58E-63 mr1861 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 2.29E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 1.45E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 3.02E-06 3.02E-06 mr1955 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 4.14E-06 2.99E-70 mr1962 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 1.24E-43 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 5.33E-09 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 3.78E-43 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 2.81E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 9.14E-25 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 4.61E-63 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 1.04E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 1.46E-30 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 2.23E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 6.02E-08 mr1299_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 7.61E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 2.03E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 1.04E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 8.12E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 4.29E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 4.67E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 6.65E-31 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 1.23E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 3.44E-19 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 3.82E-06 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 6.16E-10 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 8.00E-16 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 8.25E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 2.77E-56 mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 3.99E-35 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 4.00E-30 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705306490 NA 4.99E-122 mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251