\
| Variant ID: vg0705295921 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5295921 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ATGTATGCAAAATAGATTTATTCCATCTATATAAGATACGGCGCAAAGAGATGAGGAAGGTAAAATAGACTTATTCCAAGGAGGAGCGCGGTGGGCTTTC[A/G]
TGACTTCGAGCCAGCCGACACGGTCCGAGTTTTATTGGGCCTTGCTTGGGTCGTTGGTGTAGCCTGTGGGCGAGCACGGCTAGCCTCGGCATGTAGGTCG
CGACCTACATGCCGAGGCTAGCCGTGCTCGCCCACAGGCTACACCAACGACCCAAGCAAGGCCCAATAAAACTCGGACCGTGTCGGCTGGCTCGAAGTCA[T/C]
GAAAGCCCACCGCGCTCCTCCTTGGAATAAGTCTATTTTACCTTCCTCATCTCTTTGCGCCGTATCTTATATAGATGGAATAAATCTATTTTGCATACAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.90% | 5.50% | 0.40% | 58.25% | NA |
| All Indica | 2759 | 4.10% | 6.50% | 0.58% | 88.84% | NA |
| All Japonica | 1512 | 94.80% | 4.80% | 0.00% | 0.40% | NA |
| Aus | 269 | 3.00% | 0.70% | 1.12% | 95.17% | NA |
| Indica I | 595 | 2.90% | 0.00% | 0.34% | 96.81% | NA |
| Indica II | 465 | 4.70% | 4.90% | 1.08% | 89.25% | NA |
| Indica III | 913 | 3.80% | 11.40% | 0.33% | 84.45% | NA |
| Indica Intermediate | 786 | 5.00% | 6.60% | 0.76% | 87.66% | NA |
| Temperate Japonica | 767 | 91.50% | 8.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 95.00% | 3.70% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 57.80% | 4.40% | 0.00% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705295921 | A -> DEL | N | N | silent_mutation | Average:13.343; most accessible tissue: Callus, score: 77.093 | N | N | N | N |
| vg0705295921 | A -> G | LOC_Os07g09940.1 | upstream_gene_variant ; 2035.0bp to feature; MODIFIER | silent_mutation | Average:13.343; most accessible tissue: Callus, score: 77.093 | N | N | N | N |
| vg0705295921 | A -> G | LOC_Os07g09940-LOC_Os07g09950 | intergenic_region ; MODIFIER | silent_mutation | Average:13.343; most accessible tissue: Callus, score: 77.093 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705295921 | NA | 7.59E-07 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705295921 | NA | 4.46E-06 | mr1354 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705295921 | 1.61E-07 | NA | mr1549_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705295921 | 1.30E-07 | 4.94E-09 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705295921 | NA | 1.30E-06 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705295921 | 6.41E-06 | 2.00E-07 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705295921 | 4.22E-06 | 3.01E-07 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |