\
| Variant ID: vg0705289004 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5289004 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGATGGCACGGACCCTAGACGACAAGCGAAGAAACAAATTTCGCAATTAGGGTTTTTAAGAGATAATTTTCCCGCTAGGCGCCACGACGGAACGGGCGCT[A/T]
CAAGAAGGGAGGCAGCGGGCGAGCCGTAGAGGAGTACAATGGCAAAGCTGCTGACGGTTTGGCAAGACTTCTAGAAAGTAAAAAATGAATCCAAACGATA
TATCGTTTGGATTCATTTTTTACTTTCTAGAAGTCTTGCCAAACCGTCAGCAGCTTTGCCATTGTACTCCTCTACGGCTCGCCCGCTGCCTCCCTTCTTG[T/A]
AGCGCCCGTTCCGTCGTGGCGCCTAGCGGGAAAATTATCTCTTAAAAACCCTAATTGCGAAATTTGTTTCTTCGCTTGTCGTCTAGGGTCCGTGCCATCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.50% | 2.00% | 3.15% | 59.39% | NA |
| All Indica | 2759 | 4.10% | 0.00% | 4.53% | 91.41% | NA |
| All Japonica | 1512 | 93.40% | 6.10% | 0.20% | 0.33% | NA |
| Aus | 269 | 2.20% | 0.00% | 7.81% | 89.96% | NA |
| Indica I | 595 | 2.20% | 0.00% | 0.84% | 96.97% | NA |
| Indica II | 465 | 4.50% | 0.00% | 1.72% | 93.76% | NA |
| Indica III | 913 | 4.10% | 0.00% | 8.11% | 87.84% | NA |
| Indica Intermediate | 786 | 5.20% | 0.00% | 4.83% | 89.95% | NA |
| Temperate Japonica | 767 | 90.60% | 9.00% | 0.26% | 0.13% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 89.60% | 9.10% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 0.00% | 5.21% | NA |
| Intermediate | 90 | 61.10% | 2.20% | 0.00% | 36.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705289004 | A -> DEL | N | N | silent_mutation | Average:9.754; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg0705289004 | A -> T | LOC_Os07g09930.1 | downstream_gene_variant ; 2354.0bp to feature; MODIFIER | silent_mutation | Average:9.754; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg0705289004 | A -> T | LOC_Os07g09940.1 | downstream_gene_variant ; 3917.0bp to feature; MODIFIER | silent_mutation | Average:9.754; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| vg0705289004 | A -> T | LOC_Os07g09930-LOC_Os07g09940 | intergenic_region ; MODIFIER | silent_mutation | Average:9.754; most accessible tissue: Minghui63 panicle, score: 16.27 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705289004 | 2.71E-07 | 1.90E-10 | mr1757 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705289004 | 1.66E-09 | 1.11E-11 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705289004 | 3.38E-08 | 3.52E-09 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705289004 | NA | 1.13E-06 | mr1588_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705289004 | 2.42E-08 | 3.46E-10 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |