\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705289004:

Variant ID: vg0705289004 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5289004
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATGGCACGGACCCTAGACGACAAGCGAAGAAACAAATTTCGCAATTAGGGTTTTTAAGAGATAATTTTCCCGCTAGGCGCCACGACGGAACGGGCGCT[A/T]
CAAGAAGGGAGGCAGCGGGCGAGCCGTAGAGGAGTACAATGGCAAAGCTGCTGACGGTTTGGCAAGACTTCTAGAAAGTAAAAAATGAATCCAAACGATA

Reverse complement sequence

TATCGTTTGGATTCATTTTTTACTTTCTAGAAGTCTTGCCAAACCGTCAGCAGCTTTGCCATTGTACTCCTCTACGGCTCGCCCGCTGCCTCCCTTCTTG[T/A]
AGCGCCCGTTCCGTCGTGGCGCCTAGCGGGAAAATTATCTCTTAAAAACCCTAATTGCGAAATTTGTTTCTTCGCTTGTCGTCTAGGGTCCGTGCCATCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.50% 2.00% 3.15% 59.39% NA
All Indica  2759 4.10% 0.00% 4.53% 91.41% NA
All Japonica  1512 93.40% 6.10% 0.20% 0.33% NA
Aus  269 2.20% 0.00% 7.81% 89.96% NA
Indica I  595 2.20% 0.00% 0.84% 96.97% NA
Indica II  465 4.50% 0.00% 1.72% 93.76% NA
Indica III  913 4.10% 0.00% 8.11% 87.84% NA
Indica Intermediate  786 5.20% 0.00% 4.83% 89.95% NA
Temperate Japonica  767 90.60% 9.00% 0.26% 0.13% NA
Tropical Japonica  504 99.40% 0.20% 0.00% 0.40% NA
Japonica Intermediate  241 89.60% 9.10% 0.41% 0.83% NA
VI/Aromatic  96 94.80% 0.00% 0.00% 5.21% NA
Intermediate  90 61.10% 2.20% 0.00% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705289004 A -> DEL N N silent_mutation Average:9.754; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0705289004 A -> T LOC_Os07g09930.1 downstream_gene_variant ; 2354.0bp to feature; MODIFIER silent_mutation Average:9.754; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0705289004 A -> T LOC_Os07g09940.1 downstream_gene_variant ; 3917.0bp to feature; MODIFIER silent_mutation Average:9.754; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N
vg0705289004 A -> T LOC_Os07g09930-LOC_Os07g09940 intergenic_region ; MODIFIER silent_mutation Average:9.754; most accessible tissue: Minghui63 panicle, score: 16.27 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705289004 2.71E-07 1.90E-10 mr1757 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705289004 1.66E-09 1.11E-11 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705289004 3.38E-08 3.52E-09 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705289004 NA 1.13E-06 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705289004 2.42E-08 3.46E-10 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251