\
| Variant ID: vg0705226228 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5226228 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.03, others allele: 0.00, population size: 268. )
TCAAGTAATTCATCATCCTGTGGTTTGACATGATAATTTTGCATTATTGGTAATAAAAGATAATATTTGTCCCCAAAAGGCCTTACTGTGGGCAACTCTA[G/A]
AACCTTTTCCATAGTATCATAGCCATGACCATGAGTTTTTATGTACTCCATGGTCCACCATGCTTATATTTATCTTTGGTTTTTACTGTCTGTTTCCTTT
AAAGGAAACAGACAGTAAAAACCAAAGATAAATATAAGCATGGTGGACCATGGAGTACATAAAAACTCATGGTCATGGCTATGATACTATGGAAAAGGTT[C/T]
TAGAGTTGCCCACAGTAAGGCCTTTTGGGGACAAATATTATCTTTTATTACCAATAATGCAAAATTATCATGTCAAACCACAGGATGATGAATTACTTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 48.40% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 84.30% | 15.40% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 24.20% | 75.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.80% | 6.10% | 0.17% | 0.00% | NA |
| Indica II | 465 | 90.10% | 9.20% | 0.65% | 0.00% | NA |
| Indica III | 913 | 76.50% | 23.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 82.80% | 16.90% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 37.80% | 62.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705226228 | G -> A | LOC_Os07g09830.1 | downstream_gene_variant ; 2628.0bp to feature; MODIFIER | silent_mutation | Average:47.113; most accessible tissue: Callus, score: 91.902 | N | N | N | N |
| vg0705226228 | G -> A | LOC_Os07g09814.3 | downstream_gene_variant ; 2447.0bp to feature; MODIFIER | silent_mutation | Average:47.113; most accessible tissue: Callus, score: 91.902 | N | N | N | N |
| vg0705226228 | G -> A | LOC_Os07g09814.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.113; most accessible tissue: Callus, score: 91.902 | N | N | N | N |
| vg0705226228 | G -> A | LOC_Os07g09814.2 | intron_variant ; MODIFIER | silent_mutation | Average:47.113; most accessible tissue: Callus, score: 91.902 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705226228 | NA | 3.61E-32 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705226228 | NA | 2.41E-10 | mr1151 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705226228 | NA | 9.62E-07 | mr1152 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705226228 | NA | 1.17E-32 | mr1213 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705226228 | NA | 1.38E-14 | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705226228 | NA | 8.98E-14 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705226228 | NA | 1.31E-08 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705226228 | NA | 8.05E-06 | mr1707 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705226228 | NA | 3.05E-15 | mr1744 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705226228 | NA | 1.03E-15 | mr1744_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705226228 | NA | 3.86E-07 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |