\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705219339:

Variant ID: vg0705219339 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5219339
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTTTCCATGGGCCCTACCCAAACGAAACCTCCAGATGGGCCGTACTCTCGGCTGCCCATGGGCCGGGCCCCAACGGAACGCACGGATAGGTTGGGCTTG[G/T]
GCTGGATTGGACATGACGCCATTTGAAGGCCCATCCAGACAGCGAGAGCGGCGCCGCGGCCGCTACTTCTACCCGCCGCCGCCTCTCCACTCCACTCCAC

Reverse complement sequence

GTGGAGTGGAGTGGAGAGGCGGCGGCGGGTAGAAGTAGCGGCCGCGGCGCCGCTCTCGCTGTCTGGATGGGCCTTCAAATGGCGTCATGTCCAATCCAGC[C/A]
CAAGCCCAACCTATCCGTGCGTTCCGTTGGGGCCCGGCCCATGGGCAGCCGAGAGTACGGCCCATCTGGAGGTTTCGTTTGGGTAGGGCCCATGGAAACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.10% 4.80% 0.04% 0.00% NA
All Indica  2759 98.90% 1.00% 0.04% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 26.40% 73.20% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.70% 1.20% 0.11% 0.00% NA
Indica Intermediate  786 98.00% 2.00% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705219339 G -> T LOC_Os07g09800.1 upstream_gene_variant ; 2243.0bp to feature; MODIFIER silent_mutation Average:87.653; most accessible tissue: Minghui63 young leaf, score: 99.217 N N N N
vg0705219339 G -> T LOC_Os07g09814.1 upstream_gene_variant ; 99.0bp to feature; MODIFIER silent_mutation Average:87.653; most accessible tissue: Minghui63 young leaf, score: 99.217 N N N N
vg0705219339 G -> T LOC_Os07g09814.3 upstream_gene_variant ; 99.0bp to feature; MODIFIER silent_mutation Average:87.653; most accessible tissue: Minghui63 young leaf, score: 99.217 N N N N
vg0705219339 G -> T LOC_Os07g09814.2 upstream_gene_variant ; 99.0bp to feature; MODIFIER silent_mutation Average:87.653; most accessible tissue: Minghui63 young leaf, score: 99.217 N N N N
vg0705219339 G -> T LOC_Os07g09800-LOC_Os07g09814 intergenic_region ; MODIFIER silent_mutation Average:87.653; most accessible tissue: Minghui63 young leaf, score: 99.217 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0705219339 G T -0.1 -0.13 -0.09 -0.09 -0.06 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705219339 NA 2.03E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219339 NA 1.93E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219339 NA 9.33E-12 mr1522 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219339 NA 6.38E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219339 3.35E-06 1.18E-53 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219339 7.86E-10 5.27E-66 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219339 4.64E-06 1.08E-55 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219339 NA 2.90E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219339 NA 1.73E-10 mr1931 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219339 NA 1.32E-12 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219339 NA 2.31E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219339 7.09E-08 7.52E-50 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219339 2.34E-10 1.77E-74 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219339 4.83E-07 2.34E-43 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219339 NA 3.95E-06 mr1762_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251