\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705219291:

Variant ID: vg0705219291 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5219291
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGGCCAGCCCCAAACACACTAATCAAATGGACCGTTCTCCTTTGTGGGTTTCCATGGGCCCTACCCAAACGAAACCTCCAGATGGGCCGTACTCTCGG[C/T]
TGCCCATGGGCCGGGCCCCAACGGAACGCACGGATAGGTTGGGCTTGGGCTGGATTGGACATGACGCCATTTGAAGGCCCATCCAGACAGCGAGAGCGGC

Reverse complement sequence

GCCGCTCTCGCTGTCTGGATGGGCCTTCAAATGGCGTCATGTCCAATCCAGCCCAAGCCCAACCTATCCGTGCGTTCCGTTGGGGCCCGGCCCATGGGCA[G/A]
CCGAGAGTACGGCCCATCTGGAGGTTTCGTTTGGGTAGGGCCCATGGAAACCCACAAAGGAGAACGGTCCATTTGATTAGTGTGTTTGGGGCTGGCCCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.40% 44.60% 0.32% 0.63% NA
All Indica  2759 25.70% 72.70% 0.54% 1.09% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 75.80% 24.20% 0.00% 0.00% NA
Indica I  595 8.10% 90.60% 0.50% 0.84% NA
Indica II  465 10.80% 84.30% 1.08% 3.87% NA
Indica III  913 43.40% 56.30% 0.22% 0.11% NA
Indica Intermediate  786 27.20% 71.40% 0.64% 0.76% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 63.30% 36.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705219291 C -> DEL N N silent_mutation Average:84.724; most accessible tissue: Callus, score: 99.835 N N N N
vg0705219291 C -> T LOC_Os07g09800.1 upstream_gene_variant ; 2195.0bp to feature; MODIFIER silent_mutation Average:84.724; most accessible tissue: Callus, score: 99.835 N N N N
vg0705219291 C -> T LOC_Os07g09814.1 upstream_gene_variant ; 147.0bp to feature; MODIFIER silent_mutation Average:84.724; most accessible tissue: Callus, score: 99.835 N N N N
vg0705219291 C -> T LOC_Os07g09814.3 upstream_gene_variant ; 147.0bp to feature; MODIFIER silent_mutation Average:84.724; most accessible tissue: Callus, score: 99.835 N N N N
vg0705219291 C -> T LOC_Os07g09814.2 upstream_gene_variant ; 147.0bp to feature; MODIFIER silent_mutation Average:84.724; most accessible tissue: Callus, score: 99.835 N N N N
vg0705219291 C -> T LOC_Os07g09800-LOC_Os07g09814 intergenic_region ; MODIFIER silent_mutation Average:84.724; most accessible tissue: Callus, score: 99.835 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0705219291 C T -0.07 -0.09 -0.05 -0.06 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705219291 NA 9.71E-44 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 3.24E-09 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 9.12E-34 mr1213 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 8.18E-08 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 8.60E-45 mr1234 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 2.77E-06 mr1422 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 3.38E-13 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 6.77E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 1.36E-15 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 1.70E-06 mr1870 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 8.31E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 4.82E-58 mr1234_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 5.13E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 2.26E-06 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 3.31E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 2.38E-15 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 1.58E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 3.53E-18 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 5.98E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705219291 NA 1.55E-06 mr1966_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251