\
| Variant ID: vg0705191402 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5191402 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACTGCTCTGATCGAGGAGCTCGTTCTTCCTCCTGCAGCAATGGTGAACCATCACGATGACTCTGTCTCTGACATCGCCGATCATGGCTGCTCCGGCGCCG[C/T]
TCCTCCTCCTTCAGCAGTGGTGGACCTCCCCGATGACTCTGACGGCGCCGATCAGAGCTGCTCCGGCATGGTGGATGATTCCCTTCCCGGGTACTATGAG
CTCATAGTACCCGGGAAGGGAATCATCCACCATGCCGGAGCAGCTCTGATCGGCGCCGTCAGAGTCATCGGGGAGGTCCACCACTGCTGAAGGAGGAGGA[G/A]
CGGCGCCGGAGCAGCCATGATCGGCGATGTCAGAGACAGAGTCATCGTGATGGTTCACCATTGCTGCAGGAGGAAGAACGAGCTCCTCGATCAGAGCAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.10% | 47.80% | 0.04% | 0.08% | NA |
| All Indica | 2759 | 76.80% | 23.00% | 0.07% | 0.14% | NA |
| All Japonica | 1512 | 2.70% | 97.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.30% | 2.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 89.50% | 10.10% | 0.22% | 0.22% | NA |
| Indica III | 913 | 57.10% | 42.70% | 0.00% | 0.22% | NA |
| Indica Intermediate | 786 | 76.70% | 23.00% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 4.70% | 95.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.20% | 98.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 57.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705191402 | C -> DEL | LOC_Os07g09740.1 | N | frameshift_variant | Average:58.679; most accessible tissue: Minghui63 flag leaf, score: 74.955 | N | N | N | N |
| vg0705191402 | C -> T | LOC_Os07g09740.1 | missense_variant ; p.Ala533Val; MODERATE | nonsynonymous_codon ; A533V | Average:58.679; most accessible tissue: Minghui63 flag leaf, score: 74.955 | benign |
-1.069 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705191402 | NA | 4.79E-27 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705191402 | NA | 5.13E-06 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705191402 | NA | 7.50E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705191402 | NA | 1.17E-06 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705191402 | NA | 3.81E-28 | mr1723 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705191402 | NA | 9.32E-06 | mr1870 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705191402 | NA | 5.45E-27 | mr1074_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705191402 | NA | 1.54E-09 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705191402 | NA | 9.20E-19 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705191402 | 1.36E-08 | 1.61E-09 | mr1588_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705191402 | NA | 2.11E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705191402 | NA | 1.11E-32 | mr1723_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |