| Variant ID: vg0705107520 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5107520 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 259. )
ACATTACTGTGATGTACTCCCTTCGTCCCAAAATAACAACTTAGGATCGGACGTGACACATTCTATAACGAATCTTGACATGTTAGTTTTTTATGGCACA[G/A]
TATATGTAATTTAACACATTTTAGTATAATGAATCTACACATATTGATTTTTTATGGCACAGATGATGTATATATAAGTTGGTAAAATTTGCTACAGGAC
GTCCTGTAGCAAATTTTACCAACTTATATATACATCATCTGTGCCATAAAAAATCAATATGTGTAGATTCATTATACTAAAATGTGTTAAATTACATATA[C/T]
TGTGCCATAAAAAACTAACATGTCAAGATTCGTTATAGAATGTGTCACGTCCGATCCTAAGTTGTTATTTTGGGACGAAGGGAGTACATCACAGTAATGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.80% | 3.70% | 0.51% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.40% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 88.30% | 10.50% | 1.19% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.60% | 1.90% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.20% | 0.40% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 68.10% | 29.60% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 2.90% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705107520 | G -> A | LOC_Os07g09610.1 | downstream_gene_variant ; 222.0bp to feature; MODIFIER | silent_mutation | Average:44.733; most accessible tissue: Callus, score: 70.908 | N | N | N | N |
| vg0705107520 | G -> A | LOC_Os07g09620.1 | downstream_gene_variant ; 1522.0bp to feature; MODIFIER | silent_mutation | Average:44.733; most accessible tissue: Callus, score: 70.908 | N | N | N | N |
| vg0705107520 | G -> A | LOC_Os07g09610-LOC_Os07g09620 | intergenic_region ; MODIFIER | silent_mutation | Average:44.733; most accessible tissue: Callus, score: 70.908 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705107520 | NA | 4.88E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705107520 | NA | 8.70E-06 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705107520 | 7.59E-10 | 2.11E-10 | mr1082_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705107520 | 3.23E-08 | 1.61E-09 | mr1083_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705107520 | 1.05E-06 | NA | mr1103_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705107520 | 1.22E-06 | 6.48E-06 | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705107520 | NA | 7.88E-06 | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705107520 | 9.01E-06 | 8.56E-07 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705107520 | 3.78E-06 | 5.00E-08 | mr1408_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |