Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0705102263:

Variant ID: vg0705102263 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5102263
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGATTCTTCCTCCGGTGATTCCAATGCACATAATGTAGACGCCACATAGTGATGCTACGTACTCCATCCGTCCCATAAAAAACCAACCTAATACCGGGT[A/G]
TGACACATCCTAATATTACGAATCTAGATATATATGTACAGATTCATCGTACTAGAATATGTTACATCTAGTTGTAGATTTATTTTTTATGAGACGGAGG

Reverse complement sequence

CCTCCGTCTCATAAAAAATAAATCTACAACTAGATGTAACATATTCTAGTACGATGAATCTGTACATATATATCTAGATTCGTAATATTAGGATGTGTCA[T/C]
ACCCGGTATTAGGTTGGTTTTTTATGGGACGGATGGAGTACGTAGCATCACTATGTGGCGTCTACATTATGTGCATTGGAATCACCGGAGGAAGAATCAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 10.20% 5.78% 0.00% NA
All Indica  2759 96.40% 0.70% 2.83% 0.00% NA
All Japonica  1512 58.00% 29.60% 12.43% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.80% 1.50% 6.72% 0.00% NA
Indica II  465 96.10% 1.30% 2.58% 0.00% NA
Indica III  913 99.90% 0.00% 0.11% 0.00% NA
Indica Intermediate  786 96.20% 0.60% 3.18% 0.00% NA
Temperate Japonica  767 37.90% 42.80% 19.30% 0.00% NA
Tropical Japonica  504 87.90% 8.90% 3.17% 0.00% NA
Japonica Intermediate  241 59.30% 30.70% 9.96% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 78.90% 14.40% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705102263 A -> G LOC_Os07g09610.1 upstream_gene_variant ; 246.0bp to feature; MODIFIER silent_mutation Average:81.108; most accessible tissue: Callus, score: 97.363 N N N N
vg0705102263 A -> G LOC_Os07g09600.1 downstream_gene_variant ; 2751.0bp to feature; MODIFIER silent_mutation Average:81.108; most accessible tissue: Callus, score: 97.363 N N N N
vg0705102263 A -> G LOC_Os07g09600-LOC_Os07g09610 intergenic_region ; MODIFIER silent_mutation Average:81.108; most accessible tissue: Callus, score: 97.363 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0705102263 A G 0.01 -0.03 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705102263 NA 1.86E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0705102263 1.30E-06 1.62E-14 mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705102263 NA 1.12E-06 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705102263 NA 1.34E-06 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705102263 NA 7.87E-07 mr1708 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705102263 NA 1.34E-09 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705102263 NA 7.22E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251