\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705087105:

Variant ID: vg0705087105 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5087105
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGTAGGTAGGAAGTAATCTTAGATTAACCGTATCATCTTAGTATAATTATTTAAGAGTAAAGTGTACTGGCGGTCCTTAAACTTGTAAGGGTGTGTCAT[C/T,A]
TAGGTCCCTAAACTCTCAAAATACATATCCAAATCCTAGAACTTGTCATAGTGTGTCATCTAGGTCCCAAATCGCCATAACCCCTACAGGATCCTACGTG

Reverse complement sequence

CACGTAGGATCCTGTAGGGGTTATGGCGATTTGGGACCTAGATGACACACTATGACAAGTTCTAGGATTTGGATATGTATTTTGAGAGTTTAGGGACCTA[G/A,T]
ATGACACACCCTTACAAGTTTAAGGACCGCCAGTACACTTTACTCTTAAATAATTATACTAAGATGATACGGTTAATCTAAGATTACTTCCTACCTACGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 10.30% 0.02% 0.00% A: 0.04%
All Indica  2759 91.20% 8.70% 0.04% 0.00% A: 0.07%
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 12.60% 87.40% 0.00% 0.00% NA
Indica I  595 88.20% 11.80% 0.00% 0.00% NA
Indica II  465 97.60% 2.40% 0.00% 0.00% NA
Indica III  913 89.90% 10.00% 0.11% 0.00% NA
Indica Intermediate  786 91.00% 8.80% 0.00% 0.00% A: 0.25%
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705087105 C -> A LOC_Os07g09590.1 upstream_gene_variant ; 2315.0bp to feature; MODIFIER silent_mutation Average:45.884; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0705087105 C -> A LOC_Os07g09590-LOC_Os07g09600 intergenic_region ; MODIFIER silent_mutation Average:45.884; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0705087105 C -> T LOC_Os07g09590.1 upstream_gene_variant ; 2315.0bp to feature; MODIFIER silent_mutation Average:45.884; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N
vg0705087105 C -> T LOC_Os07g09590-LOC_Os07g09600 intergenic_region ; MODIFIER silent_mutation Average:45.884; most accessible tissue: Zhenshan97 panicle, score: 67.02 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705087105 NA 3.55E-08 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 5.43E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 5.09E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 4.48E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 2.61E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 4.26E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 4.28E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 2.76E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 3.55E-06 3.55E-06 mr1270 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 5.49E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 7.45E-06 mr1314 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 7.82E-06 7.82E-06 mr1315 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 7.86E-07 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 3.36E-08 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 2.79E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 3.42E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 4.91E-09 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 6.11E-07 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 1.14E-08 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 5.75E-08 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 6.10E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 3.09E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 2.97E-06 mr1857 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 4.45E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 4.40E-09 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 5.96E-18 mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705087105 NA 1.70E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251