Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705065736:

Variant ID: vg0705065736 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 5065736
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

GGGTAATCTGGTCCTTTTGAATTGTTTCTCTCTCCATTCAGCCCAAAAATAATAAAATAATGGTGAAAGTGTCCAACAGCTAATTACACATTTTTTAGAG[T/C]
GTCTCTTAGCCGTTTCACGATCTTACGATATCCCTCGGCTAATTACATGTTTTTTTGGATGTCTGTAACAAATTTTGCCTAGAAGTAACTATATTGCTGT

Reverse complement sequence

ACAGCAATATAGTTACTTCTAGGCAAAATTTGTTACAGACATCCAAAAAAACATGTAATTAGCCGAGGGATATCGTAAGATCGTGAAACGGCTAAGAGAC[A/G]
CTCTAAAAAATGTGTAATTAGCTGTTGGACACTTTCACCATTATTTTATTATTTTTGGGCTGAATGGAGAGAGAAACAATTCAAAAGGACCAGATTACCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.20%	2.90%	0.91%	0.00%	NA
All Indica	2759	99.50%	0.10%	0.43%	0.00%	NA
All Japonica	1512	89.20%	8.70%	2.05%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.00%	0.67%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	0.10%	1.02%	0.00%	NA
Temperate Japonica	767	98.20%	0.30%	1.56%	0.00%	NA
Tropical Japonica	504	73.00%	24.00%	2.98%	0.00%	NA
Japonica Intermediate	241	94.60%	3.70%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0705065736	T -> C	LOC_Os07g09570.1	upstream_gene_variant ; 288.0bp to feature; MODIFIER	silent_mutation	Average:60.549; most accessible tissue: Minghui63 root, score: 80.951	N	N	N	N
vg0705065736	T -> C	LOC_Os07g09560.1	downstream_gene_variant ; 2619.0bp to feature; MODIFIER	silent_mutation	Average:60.549; most accessible tissue: Minghui63 root, score: 80.951	N	N	N	N
vg0705065736	T -> C	LOC_Os07g09570-LOC_Os07g09580	intergenic_region ; MODIFIER	silent_mutation	Average:60.549; most accessible tissue: Minghui63 root, score: 80.951	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0705065736	NA	1.20E-06	mr1232_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	1.09E-07	mr1308_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	9.97E-06	mr1409_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	7.42E-06	7.42E-06	mr1424_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	4.96E-07	mr1551_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	1.19E-06	mr1557_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	2.61E-08	mr1558_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	2.89E-06	2.89E-06	mr1562_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	2.92E-06	mr1575_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	9.15E-06	mr1600_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	2.78E-06	mr1606_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	3.42E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	9.14E-06	mr1702_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	5.00E-07	mr1849_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	8.35E-07	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	2.90E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	1.93E-06	mr1873_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	1.53E-06	mr1884_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	7.92E-10	mr1905_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	2.57E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	8.32E-10	mr1942_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736	NA	2.48E-06	mr1944_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251