\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705065736:

Variant ID: vg0705065736 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5065736
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GGGTAATCTGGTCCTTTTGAATTGTTTCTCTCTCCATTCAGCCCAAAAATAATAAAATAATGGTGAAAGTGTCCAACAGCTAATTACACATTTTTTAGAG[T/C]
GTCTCTTAGCCGTTTCACGATCTTACGATATCCCTCGGCTAATTACATGTTTTTTTGGATGTCTGTAACAAATTTTGCCTAGAAGTAACTATATTGCTGT

Reverse complement sequence

ACAGCAATATAGTTACTTCTAGGCAAAATTTGTTACAGACATCCAAAAAAACATGTAATTAGCCGAGGGATATCGTAAGATCGTGAAACGGCTAAGAGAC[A/G]
CTCTAAAAAATGTGTAATTAGCTGTTGGACACTTTCACCATTATTTTATTATTTTTGGGCTGAATGGAGAGAGAAACAATTCAAAAGGACCAGATTACCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.20% 2.90% 0.91% 0.00% NA
All Indica  2759 99.50% 0.10% 0.43% 0.00% NA
All Japonica  1512 89.20% 8.70% 2.05% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.00% 0.67% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 0.10% 1.02% 0.00% NA
Temperate Japonica  767 98.20% 0.30% 1.56% 0.00% NA
Tropical Japonica  504 73.00% 24.00% 2.98% 0.00% NA
Japonica Intermediate  241 94.60% 3.70% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705065736 T -> C LOC_Os07g09570.1 upstream_gene_variant ; 288.0bp to feature; MODIFIER silent_mutation Average:60.549; most accessible tissue: Minghui63 root, score: 80.951 N N N N
vg0705065736 T -> C LOC_Os07g09560.1 downstream_gene_variant ; 2619.0bp to feature; MODIFIER silent_mutation Average:60.549; most accessible tissue: Minghui63 root, score: 80.951 N N N N
vg0705065736 T -> C LOC_Os07g09570-LOC_Os07g09580 intergenic_region ; MODIFIER silent_mutation Average:60.549; most accessible tissue: Minghui63 root, score: 80.951 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705065736 NA 1.20E-06 mr1232_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 1.09E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 9.97E-06 mr1409_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 7.42E-06 7.42E-06 mr1424_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 4.96E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 1.19E-06 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 2.61E-08 mr1558_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 2.89E-06 2.89E-06 mr1562_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 2.92E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 9.15E-06 mr1600_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 2.78E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 3.42E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 9.14E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 5.00E-07 mr1849_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 8.35E-07 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 2.90E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 1.93E-06 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 1.53E-06 mr1884_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 7.92E-10 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 2.57E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 8.32E-10 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705065736 NA 2.48E-06 mr1944_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251