\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705035472:

Variant ID: vg0705035472 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5035472
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.11, others allele: 0.00, population size: 45. )

Flanking Sequence (100 bp) in Reference Genome:


GGGGAGGGAACAGAAGGACGACTATCCTTCTAAACAATGCTGATCAAAATCCCTTATATTTTAGATCAGATTCGTATTACTATTATGTATCATATTCGAC[C/T]
AAAATTCTTTACATTTTACAATGATGGGAGCATATATTTAAACACACTAGGTGAAACCTTGTGCGTTGCTACAGGAGTTTAGTATGACAACAATAAATAA

Reverse complement sequence

TTATTTATTGTTGTCATACTAAACTCCTGTAGCAACGCACAAGGTTTCACCTAGTGTGTTTAAATATATGCTCCCATCATTGTAAAATGTAAAGAATTTT[G/A]
GTCGAATATGATACATAATAGTAATACGAATCTGATCTAAAATATAAGGGATTTTGATCAGCATTGTTTAGAAGGATAGTCGTCCTTCTGTTCCCTCCCC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.80% 21.80% 8.34% 6.01% NA
All Indica  2759 48.00% 36.90% 9.57% 5.58% NA
All Japonica  1512 99.20% 0.20% 0.46% 0.13% NA
Aus  269 11.50% 0.40% 42.75% 45.35% NA
Indica I  595 75.00% 5.50% 12.44% 7.06% NA
Indica II  465 29.70% 58.10% 8.17% 4.09% NA
Indica III  913 41.60% 45.60% 6.90% 5.91% NA
Indica Intermediate  786 45.80% 37.90% 11.32% 4.96% NA
Temperate Japonica  767 99.20% 0.10% 0.52% 0.13% NA
Tropical Japonica  504 99.60% 0.00% 0.20% 0.20% NA
Japonica Intermediate  241 98.30% 0.80% 0.83% 0.00% NA
VI/Aromatic  96 95.80% 1.00% 0.00% 3.12% NA
Intermediate  90 76.70% 11.10% 8.89% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705035472 C -> DEL N N silent_mutation Average:44.095; most accessible tissue: Callus, score: 64.847 N N N N
vg0705035472 C -> T LOC_Os07g09530.1 downstream_gene_variant ; 1648.0bp to feature; MODIFIER silent_mutation Average:44.095; most accessible tissue: Callus, score: 64.847 N N N N
vg0705035472 C -> T LOC_Os07g09530-LOC_Os07g09540 intergenic_region ; MODIFIER silent_mutation Average:44.095; most accessible tissue: Callus, score: 64.847 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705035472 NA 2.47E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705035472 NA 9.24E-07 mr1679 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705035472 NA 2.37E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705035472 NA 8.18E-09 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705035472 NA 3.02E-08 mr1693 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705035472 NA 4.60E-06 mr1733 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705035472 NA 5.34E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705035472 NA 2.37E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705035472 NA 4.09E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705035472 NA 3.74E-06 mr1691_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251