\
| Variant ID: vg0705035472 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5035472 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.11, others allele: 0.00, population size: 45. )
GGGGAGGGAACAGAAGGACGACTATCCTTCTAAACAATGCTGATCAAAATCCCTTATATTTTAGATCAGATTCGTATTACTATTATGTATCATATTCGAC[C/T]
AAAATTCTTTACATTTTACAATGATGGGAGCATATATTTAAACACACTAGGTGAAACCTTGTGCGTTGCTACAGGAGTTTAGTATGACAACAATAAATAA
TTATTTATTGTTGTCATACTAAACTCCTGTAGCAACGCACAAGGTTTCACCTAGTGTGTTTAAATATATGCTCCCATCATTGTAAAATGTAAAGAATTTT[G/A]
GTCGAATATGATACATAATAGTAATACGAATCTGATCTAAAATATAAGGGATTTTGATCAGCATTGTTTAGAAGGATAGTCGTCCTTCTGTTCCCTCCCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.80% | 21.80% | 8.34% | 6.01% | NA |
| All Indica | 2759 | 48.00% | 36.90% | 9.57% | 5.58% | NA |
| All Japonica | 1512 | 99.20% | 0.20% | 0.46% | 0.13% | NA |
| Aus | 269 | 11.50% | 0.40% | 42.75% | 45.35% | NA |
| Indica I | 595 | 75.00% | 5.50% | 12.44% | 7.06% | NA |
| Indica II | 465 | 29.70% | 58.10% | 8.17% | 4.09% | NA |
| Indica III | 913 | 41.60% | 45.60% | 6.90% | 5.91% | NA |
| Indica Intermediate | 786 | 45.80% | 37.90% | 11.32% | 4.96% | NA |
| Temperate Japonica | 767 | 99.20% | 0.10% | 0.52% | 0.13% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 1.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 76.70% | 11.10% | 8.89% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705035472 | C -> DEL | N | N | silent_mutation | Average:44.095; most accessible tissue: Callus, score: 64.847 | N | N | N | N |
| vg0705035472 | C -> T | LOC_Os07g09530.1 | downstream_gene_variant ; 1648.0bp to feature; MODIFIER | silent_mutation | Average:44.095; most accessible tissue: Callus, score: 64.847 | N | N | N | N |
| vg0705035472 | C -> T | LOC_Os07g09530-LOC_Os07g09540 | intergenic_region ; MODIFIER | silent_mutation | Average:44.095; most accessible tissue: Callus, score: 64.847 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705035472 | NA | 2.47E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705035472 | NA | 9.24E-07 | mr1679 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705035472 | NA | 2.37E-06 | mr1691 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705035472 | NA | 8.18E-09 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705035472 | NA | 3.02E-08 | mr1693 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705035472 | NA | 4.60E-06 | mr1733 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705035472 | NA | 5.34E-09 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705035472 | NA | 2.37E-06 | mr1679_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705035472 | NA | 4.09E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705035472 | NA | 3.74E-06 | mr1691_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |