\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704871363:

Variant ID: vg0704871363 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4871363
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCCTTGGCTCTTATTGATGGTCATTGCATAACAAAGTCGAACAGGAAATTGTCGGCAGCTAAGAACAAAAGGCCATTTAGTGCTTGATACATGCAATG[C/G,T]
GATTCGAGGGAGAAGGACTTTATGACCTATATGTGAACCTGTAATGATTTCAGCCTCCAAAACTCGATCACCTAGCTGTGTTATTATAAGCCGCGTGCCA

Reverse complement sequence

TGGCACGCGGCTTATAATAACACAGCTAGGTGATCGAGTTTTGGAGGCTGAAATCATTACAGGTTCACATATAGGTCATAAAGTCCTTCTCCCTCGAATC[G/C,A]
CATTGCATGTATCAAGCACTAAATGGCCTTTTGTTCTTAGCTGCCGACAATTTCCTGTTCGACTTTGTTATGCAATGACCATCAATAAGAGCCAAGGACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.10% 8.10% 1.31% 3.45% T: 0.04%
All Indica  2759 98.40% 1.10% 0.18% 0.22% T: 0.07%
All Japonica  1512 81.20% 12.00% 2.51% 4.30% NA
Aus  269 32.70% 41.30% 3.72% 22.30% NA
Indica I  595 99.70% 0.00% 0.34% 0.00% NA
Indica II  465 98.10% 1.70% 0.00% 0.22% NA
Indica III  913 98.90% 0.90% 0.00% 0.00% T: 0.22%
Indica Intermediate  786 97.20% 1.80% 0.38% 0.64% NA
Temperate Japonica  767 98.30% 0.90% 0.65% 0.13% NA
Tropical Japonica  504 49.80% 32.50% 5.36% 12.30% NA
Japonica Intermediate  241 92.10% 4.60% 2.49% 0.83% NA
VI/Aromatic  96 14.60% 54.20% 3.12% 28.12% NA
Intermediate  90 78.90% 8.90% 6.67% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704871363 C -> DEL N N silent_mutation Average:36.917; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0704871363 C -> G LOC_Os07g09290-LOC_Os07g09310 intergenic_region ; MODIFIER silent_mutation Average:36.917; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0704871363 C -> T LOC_Os07g09290-LOC_Os07g09310 intergenic_region ; MODIFIER silent_mutation Average:36.917; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704871363 NA 6.25E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 1.51E-06 NA mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 NA 1.44E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 NA 1.32E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 6.48E-06 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 NA 3.80E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 NA 4.43E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 NA 6.20E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 9.49E-10 NA mr1082_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 NA 2.23E-07 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 7.94E-09 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 NA 2.26E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 1.31E-06 NA mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 4.59E-09 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 NA 8.53E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 4.59E-08 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 NA 6.15E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 1.79E-06 NA mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 2.24E-07 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363 2.65E-08 1.38E-12 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251