Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704871363:

Variant ID: vg0704871363 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 4871363
Reference Allele: C	Alternative Allele: G,T
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCCTTGGCTCTTATTGATGGTCATTGCATAACAAAGTCGAACAGGAAATTGTCGGCAGCTAAGAACAAAAGGCCATTTAGTGCTTGATACATGCAATG[C/G,T]
GATTCGAGGGAGAAGGACTTTATGACCTATATGTGAACCTGTAATGATTTCAGCCTCCAAAACTCGATCACCTAGCTGTGTTATTATAAGCCGCGTGCCA

Reverse complement sequence

TGGCACGCGGCTTATAATAACACAGCTAGGTGATCGAGTTTTGGAGGCTGAAATCATTACAGGTTCACATATAGGTCATAAAGTCCTTCTCCCTCGAATC[G/C,A]
CATTGCATGTATCAAGCACTAAATGGCCTTTTGTTCTTAGCTGCCGACAATTTCCTGTTCGACTTTGTTATGCAATGACCATCAATAAGAGCCAAGGACA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.10%	8.10%	1.31%	3.45%	T: 0.04%
All Indica	2759	98.40%	1.10%	0.18%	0.22%	T: 0.07%
All Japonica	1512	81.20%	12.00%	2.51%	4.30%	NA
Aus	269	32.70%	41.30%	3.72%	22.30%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	98.10%	1.70%	0.00%	0.22%	NA
Indica III	913	98.90%	0.90%	0.00%	0.00%	T: 0.22%
Indica Intermediate	786	97.20%	1.80%	0.38%	0.64%	NA
Temperate Japonica	767	98.30%	0.90%	0.65%	0.13%	NA
Tropical Japonica	504	49.80%	32.50%	5.36%	12.30%	NA
Japonica Intermediate	241	92.10%	4.60%	2.49%	0.83%	NA
VI/Aromatic	96	14.60%	54.20%	3.12%	28.12%	NA
Intermediate	90	78.90%	8.90%	6.67%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0704871363	C -> DEL	N	N	silent_mutation	Average:36.917; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N
vg0704871363	C -> G	LOC_Os07g09290-LOC_Os07g09310	intergenic_region ; MODIFIER	silent_mutation	Average:36.917; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N
vg0704871363	C -> T	LOC_Os07g09290-LOC_Os07g09310	intergenic_region ; MODIFIER	silent_mutation	Average:36.917; most accessible tissue: Zhenshan97 flag leaf, score: 49.845	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0704871363	NA	6.25E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	1.51E-06	NA	mr1082	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	NA	1.44E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	NA	1.32E-06	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	6.48E-06	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	NA	3.80E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	NA	4.43E-06	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	NA	6.20E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	9.49E-10	NA	mr1082_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	NA	2.23E-07	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	7.94E-09	NA	mr1083_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	NA	2.26E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	1.31E-06	NA	mr1085_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	4.59E-09	NA	mr1104_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	NA	8.53E-06	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	4.59E-08	NA	mr1107_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	NA	6.15E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	1.79E-06	NA	mr1155_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	2.24E-07	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704871363	2.65E-08	1.38E-12	mr1408_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251