Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704803343:

Variant ID: vg0704803343 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4803343
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGTAATTTTTGTTAATATTGGCTTTTAAGTCTCTACGAACAAATCTACAAAAGTTTTACTTATAAATTAATTTTAATTTTCTAATAAGCCAAATAAGC[T/C]
ATTTTAGGCAAAATAGCAACCGATAGGAGCCATAGAGGATCAGTATATGTTTACCACTTATTTGTCTAGAACTACTCATTTATTTGTTTACATACCAAAT

Reverse complement sequence

ATTTGGTATGTAAACAAATAAATGAGTAGTTCTAGACAAATAAGTGGTAAACATATACTGATCCTCTATGGCTCCTATCGGTTGCTATTTTGCCTAAAAT[A/G]
GCTTATTTGGCTTATTAGAAAATTAAAATTAATTTATAAGTAAAACTTTTGTAGATTTGTTCGTAGAGACTTAAAAGCCAATATTAACAAAAATTACATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.90% 15.80% 0.76% 0.55% NA
All Indica  2759 97.60% 0.40% 1.09% 0.91% NA
All Japonica  1512 52.80% 47.00% 0.20% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 92.70% 0.90% 4.09% 2.37% NA
Indica III  913 99.00% 0.10% 0.44% 0.44% NA
Indica Intermediate  786 97.20% 0.80% 0.76% 1.27% NA
Temperate Japonica  767 24.80% 74.80% 0.39% 0.00% NA
Tropical Japonica  504 91.90% 8.10% 0.00% 0.00% NA
Japonica Intermediate  241 60.20% 39.80% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 82.20% 15.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704803343 T -> DEL N N silent_mutation Average:22.552; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg0704803343 T -> C LOC_Os07g09180-LOC_Os07g09190 intergenic_region ; MODIFIER silent_mutation Average:22.552; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704803343 NA 1.65E-17 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0704803343 NA 8.50E-06 mr1070 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 2.16E-06 mr1092 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 7.95E-09 mr1097 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 3.18E-06 3.18E-06 mr1128 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 3.85E-29 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 1.63E-06 mr1154 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 1.25E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 7.07E-27 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 8.57E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 8.26E-09 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 1.33E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 1.97E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 1.13E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 1.42E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 6.32E-33 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 7.21E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 7.35E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 3.22E-07 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 3.50E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 7.91E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 1.50E-10 mr1282_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 1.86E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 3.41E-10 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 1.53E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 1.04E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 1.97E-09 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704803343 NA 9.53E-12 mr1825_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251