Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704778806:

Variant ID: vg0704778806 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 4778806
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

GAAGCTAAATTAAATGCAATATTTATAGAAGGGACGTCACTATGCAGCTAGTGGTAGCTGGTTTGTCTAAAACAGTTACCACTCCGTCTATAAGAGGCAA[C/T]
ATCCACCTATACTTCAAATACAATTTTCTCTTAAACTACTCATCCGATCTACGATCCGATTACACCGTTGTGTTCGTAACAATTAAATCTTTACAATAAG

Reverse complement sequence

CTTATTGTAAAGATTTAATTGTTACGAACACAACGGTGTAATCGGATCGTAGATCGGATGAGTAGTTTAAGAGAAAATTGTATTTGAAGTATAGGTGGAT[G/A]
TTGCCTCTTATAGACGGAGTGGTAACTGTTTTAGACAAACCAGCTACCACTAGCTGCATAGTGACGTCCCTTCTATAAATATTGCATTTAATTTAGCTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	47.10%	0.28%	0.13%	NA
All Indica	2759	22.50%	77.00%	0.29%	0.14%	NA
All Japonica	1512	99.40%	0.40%	0.13%	0.07%	NA
Aus	269	72.10%	27.50%	0.37%	0.00%	NA
Indica I	595	13.80%	85.70%	0.17%	0.34%	NA
Indica II	465	17.60%	82.20%	0.22%	0.00%	NA
Indica III	913	27.30%	72.40%	0.22%	0.11%	NA
Indica Intermediate	786	26.60%	72.80%	0.51%	0.13%	NA
Temperate Japonica	767	99.50%	0.50%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.20%	0.20%	0.20%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	21.10%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0704778806	C -> DEL	N	N	silent_mutation	Average:64.308; most accessible tissue: Callus, score: 87.848	N	N	N	N
vg0704778806	C -> T	LOC_Os07g09150.1	upstream_gene_variant ; 2195.0bp to feature; MODIFIER	silent_mutation	Average:64.308; most accessible tissue: Callus, score: 87.848	N	N	N	N
vg0704778806	C -> T	LOC_Os07g09140.1	downstream_gene_variant ; 4356.0bp to feature; MODIFIER	silent_mutation	Average:64.308; most accessible tissue: Callus, score: 87.848	N	N	N	N
vg0704778806	C -> T	LOC_Os07g09160.1	downstream_gene_variant ; 414.0bp to feature; MODIFIER	silent_mutation	Average:64.308; most accessible tissue: Callus, score: 87.848	N	N	N	N
vg0704778806	C -> T	LOC_Os07g09170.1	downstream_gene_variant ; 3478.0bp to feature; MODIFIER	silent_mutation	Average:64.308; most accessible tissue: Callus, score: 87.848	N	N	N	N
vg0704778806	C -> T	LOC_Os07g09140.2	downstream_gene_variant ; 4356.0bp to feature; MODIFIER	silent_mutation	Average:64.308; most accessible tissue: Callus, score: 87.848	N	N	N	N
vg0704778806	C -> T	LOC_Os07g09160-LOC_Os07g09170	intergenic_region ; MODIFIER	silent_mutation	Average:64.308; most accessible tissue: Callus, score: 87.848	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0704778806	NA	3.55E-09	mr1578	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704778806	NA	3.19E-11	mr1138_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704778806	3.32E-06	NA	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704778806	6.16E-06	NA	mr1707_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251