RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0704768024:

Variant ID: vg0704768024 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 4768024
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

TTAGGAATGACTATGGCGGCTAAACGCAATTCCTAACAACGAGAGGGAGCAGAGCTATGCTACATTTCCAAGAACTAGGTGAAACCCCGCGCATTTCTGC[G/A]
GGAATTTAGTACGATAACAATAAAAAAAATAACGTGTAATAGCTAGATAATATCAGATTAAGTAAATTAATGTGGTTTATGATAATTTTAATTTAAATAG

Reverse complement sequence

CTATTTAAATTAAAATTATCATAAACCACATTAATTTACTTAATCTGATATTATCTAGCTATTACACGTTATTTTTTTTATTGTTATCGTACTAAATTCC[C/T]
GCAGAAATGCGCGGGGTTTCACCTAGTTCTTGGAAATGTAGCATAGCTCTGCTCCCTCTCGTTGTTAGGAATTGCGTTTAGCCGCCATAGTCATTCCTAA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.10%	32.60%	0.30%	0.00%	NA
All Indica	2759	78.90%	20.80%	0.29%	0.00%	NA
All Japonica	1512	40.10%	59.70%	0.26%	0.00%	NA
Aus	269	93.30%	6.70%	0.00%	0.00%	NA
Indica I	595	86.10%	13.60%	0.34%	0.00%	NA
Indica II	465	84.90%	14.80%	0.22%	0.00%	NA
Indica III	913	73.70%	26.30%	0.00%	0.00%	NA
Indica Intermediate	786	76.10%	23.30%	0.64%	0.00%	NA
Temperate Japonica	767	9.90%	89.70%	0.39%	0.00%	NA
Tropical Japonica	504	83.50%	16.30%	0.20%	0.00%	NA
Japonica Intermediate	241	45.20%	54.80%	0.00%	0.00%	NA
VI/Aromatic	96	88.50%	11.50%	0.00%	0.00%	NA
Intermediate	90	55.60%	42.20%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0704768024	G -> A	LOC_Os07g09120.1	upstream_gene_variant ; 2969.0bp to feature; MODIFIER	silent_mutation	Average:30.083; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0704768024	G -> A	LOC_Os07g09130.1	downstream_gene_variant ; 1111.0bp to feature; MODIFIER	silent_mutation	Average:30.083; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N
vg0704768024	G -> A	LOC_Os07g09120-LOC_Os07g09130	intergenic_region ; MODIFIER	silent_mutation	Average:30.083; most accessible tissue: Zhenshan97 panicle, score: 52.263	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0704768024	NA	7.10E-06	mr1072	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024	NA	1.21E-06	mr1075	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024	NA	8.64E-07	mr1077	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024	NA	3.99E-06	mr1078	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024	NA	7.57E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024	NA	3.56E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024	NA	2.47E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024	NA	2.83E-06	mr1157	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024	NA	3.19E-07	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024	NA	4.87E-06	mr1328	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 21 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0704768024:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact