\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704768024:

Variant ID: vg0704768024 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4768024
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGGAATGACTATGGCGGCTAAACGCAATTCCTAACAACGAGAGGGAGCAGAGCTATGCTACATTTCCAAGAACTAGGTGAAACCCCGCGCATTTCTGC[G/A]
GGAATTTAGTACGATAACAATAAAAAAAATAACGTGTAATAGCTAGATAATATCAGATTAAGTAAATTAATGTGGTTTATGATAATTTTAATTTAAATAG

Reverse complement sequence

CTATTTAAATTAAAATTATCATAAACCACATTAATTTACTTAATCTGATATTATCTAGCTATTACACGTTATTTTTTTTATTGTTATCGTACTAAATTCC[C/T]
GCAGAAATGCGCGGGGTTTCACCTAGTTCTTGGAAATGTAGCATAGCTCTGCTCCCTCTCGTTGTTAGGAATTGCGTTTAGCCGCCATAGTCATTCCTAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.10% 32.60% 0.30% 0.00% NA
All Indica  2759 78.90% 20.80% 0.29% 0.00% NA
All Japonica  1512 40.10% 59.70% 0.26% 0.00% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 86.10% 13.60% 0.34% 0.00% NA
Indica II  465 84.90% 14.80% 0.22% 0.00% NA
Indica III  913 73.70% 26.30% 0.00% 0.00% NA
Indica Intermediate  786 76.10% 23.30% 0.64% 0.00% NA
Temperate Japonica  767 9.90% 89.70% 0.39% 0.00% NA
Tropical Japonica  504 83.50% 16.30% 0.20% 0.00% NA
Japonica Intermediate  241 45.20% 54.80% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 55.60% 42.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704768024 G -> A LOC_Os07g09120.1 upstream_gene_variant ; 2969.0bp to feature; MODIFIER silent_mutation Average:30.083; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0704768024 G -> A LOC_Os07g09130.1 downstream_gene_variant ; 1111.0bp to feature; MODIFIER silent_mutation Average:30.083; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0704768024 G -> A LOC_Os07g09120-LOC_Os07g09130 intergenic_region ; MODIFIER silent_mutation Average:30.083; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704768024 NA 7.10E-06 mr1072 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 1.21E-06 mr1075 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 8.64E-07 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 3.99E-06 mr1078 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 7.57E-06 mr1087 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 3.56E-06 mr1096 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 2.47E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 2.83E-06 mr1157 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 3.19E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 4.87E-06 mr1328 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 5.89E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 8.86E-08 mr1446 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 3.17E-10 mr1539 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 3.44E-08 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 1.99E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 8.68E-10 mr1693 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 4.01E-10 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 7.89E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 2.27E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 3.66E-06 3.66E-06 mr1861 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704768024 NA 1.34E-06 mr1989 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251