\
| Variant ID: vg0704768024 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 4768024 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 109. )
TTAGGAATGACTATGGCGGCTAAACGCAATTCCTAACAACGAGAGGGAGCAGAGCTATGCTACATTTCCAAGAACTAGGTGAAACCCCGCGCATTTCTGC[G/A]
GGAATTTAGTACGATAACAATAAAAAAAATAACGTGTAATAGCTAGATAATATCAGATTAAGTAAATTAATGTGGTTTATGATAATTTTAATTTAAATAG
CTATTTAAATTAAAATTATCATAAACCACATTAATTTACTTAATCTGATATTATCTAGCTATTACACGTTATTTTTTTTATTGTTATCGTACTAAATTCC[C/T]
GCAGAAATGCGCGGGGTTTCACCTAGTTCTTGGAAATGTAGCATAGCTCTGCTCCCTCTCGTTGTTAGGAATTGCGTTTAGCCGCCATAGTCATTCCTAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.10% | 32.60% | 0.30% | 0.00% | NA |
| All Indica | 2759 | 78.90% | 20.80% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 40.10% | 59.70% | 0.26% | 0.00% | NA |
| Aus | 269 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.10% | 13.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 84.90% | 14.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 73.70% | 26.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 76.10% | 23.30% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 9.90% | 89.70% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 83.50% | 16.30% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 45.20% | 54.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 42.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0704768024 | G -> A | LOC_Os07g09120.1 | upstream_gene_variant ; 2969.0bp to feature; MODIFIER | silent_mutation | Average:30.083; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0704768024 | G -> A | LOC_Os07g09130.1 | downstream_gene_variant ; 1111.0bp to feature; MODIFIER | silent_mutation | Average:30.083; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0704768024 | G -> A | LOC_Os07g09120-LOC_Os07g09130 | intergenic_region ; MODIFIER | silent_mutation | Average:30.083; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0704768024 | NA | 7.10E-06 | mr1072 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 1.21E-06 | mr1075 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 8.64E-07 | mr1077 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 3.99E-06 | mr1078 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 7.57E-06 | mr1087 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 3.56E-06 | mr1096 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 2.47E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 2.83E-06 | mr1157 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 3.19E-07 | mr1202 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 4.87E-06 | mr1328 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 5.89E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 8.86E-08 | mr1446 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 3.17E-10 | mr1539 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 3.44E-08 | mr1629 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 1.99E-06 | mr1671 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 8.68E-10 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 4.01E-10 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 7.89E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 2.27E-06 | mr1844 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | 3.66E-06 | 3.66E-06 | mr1861 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704768024 | NA | 1.34E-06 | mr1989 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |