\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704766590:

Variant ID: vg0704766590 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4766590
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATCCCGGCGCTCTCCCTCGGGCTCGCACCCACATAACCAGCAAGCCCCACCCCATCCTCCTCCCCACTCATTTGCCCCCTTTTCCAGCCCGAGCCCAAGC[C/T]
GGCTCTTCTCCATCTCTTTCTCCCTCCTCATATCTCCTCTCAAATCCACTCAATTTGAAGGCATTTTACGCTGGATTTTTTAGAAATCGAAGAGCAAGGT

Reverse complement sequence

ACCTTGCTCTTCGATTTCTAAAAAATCCAGCGTAAAATGCCTTCAAATTGAGTGGATTTGAGAGGAGATATGAGGAGGGAGAAAGAGATGGAGAAGAGCC[G/A]
GCTTGGGCTCGGGCTGGAAAAGGGGGCAAATGAGTGGGGAGGAGGATGGGGTGGGGCTTGCTGGTTATGTGGGTGCGAGCCCGAGGGAGAGCGCCGGGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.00% 19.60% 1.46% 0.00% NA
All Indica  2759 98.20% 1.70% 0.11% 0.00% NA
All Japonica  1512 58.00% 38.10% 3.90% 0.00% NA
Aus  269 26.80% 71.70% 1.49% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.80% 2.20% 0.00% 0.00% NA
Indica III  913 98.50% 1.40% 0.11% 0.00% NA
Indica Intermediate  786 96.90% 2.80% 0.25% 0.00% NA
Temperate Japonica  767 86.30% 8.30% 5.35% 0.00% NA
Tropical Japonica  504 16.70% 82.10% 1.19% 0.00% NA
Japonica Intermediate  241 54.40% 40.70% 4.98% 0.00% NA
VI/Aromatic  96 12.50% 87.50% 0.00% 0.00% NA
Intermediate  90 67.80% 28.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704766590 C -> T LOC_Os07g09120.1 upstream_gene_variant ; 1535.0bp to feature; MODIFIER silent_mutation Average:70.885; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0704766590 C -> T LOC_Os07g09130.1 downstream_gene_variant ; 2545.0bp to feature; MODIFIER silent_mutation Average:70.885; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0704766590 C -> T LOC_Os07g09120-LOC_Os07g09130 intergenic_region ; MODIFIER silent_mutation Average:70.885; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704766590 NA 3.34E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 1.68E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 4.95E-06 mr1072 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 1.15E-06 mr1075 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 1.37E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 1.03E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 8.27E-06 mr1189 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 3.12E-07 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 3.91E-07 mr1446 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 7.37E-06 mr1625 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 3.82E-08 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 1.81E-06 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 4.08E-06 mr1844 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 2.69E-06 2.69E-06 mr1861 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 1.95E-06 mr1989 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 8.98E-11 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 8.67E-07 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 6.66E-06 NA mr1085_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 2.07E-06 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 8.36E-07 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 4.47E-13 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 1.17E-16 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 1.86E-09 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704766590 NA 3.84E-12 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251