\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704750780:

Variant ID: vg0704750780 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4750780
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


GGCGGTCCTTCGAGAGAACTTGGACGTCTTTGCTTGGTCCGCGTCGGACCTCAAGGGCGTCGACCGCAGCATCGCAGAGCATCAATTGCGTGTCCGTACA[G/A]
GGTCCCGGCCGGTGCGCTAGGGGCTCCAAAAGATGTCAGTCGAGCGGGCCCAAGCAGCCCGTAAGGAGGTGAAGAAATTGCTCGAAGCAGGGGTCATTCG

Reverse complement sequence

CGAATGACCCCTGCTTCGAGCAATTTCTTCACCTCCTTACGGGCTGCTTGGGCCCGCTCGACTGACATCTTTTGGAGCCCCTAGCGCACCGGCCGGGACC[C/T]
TGTACGGACACGCAATTGATGCTCTGCGATGCTGCGGTCGACGCCCTTGAGGTCCGACGCGGACCAAGCAAAGACGTCCAAGTTCTCTCGAAGGACCGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.30% 43.50% 0.11% 2.09% NA
All Indica  2759 89.20% 7.10% 0.14% 3.52% NA
All Japonica  1512 0.50% 99.50% 0.00% 0.07% NA
Aus  269 24.20% 75.50% 0.00% 0.37% NA
Indica I  595 86.20% 8.10% 0.17% 5.55% NA
Indica II  465 90.80% 4.70% 0.00% 4.52% NA
Indica III  913 92.00% 7.60% 0.00% 0.44% NA
Indica Intermediate  786 87.30% 7.40% 0.38% 4.96% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.40% 99.20% 0.00% 0.41% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 34.40% 64.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704750780 G -> DEL N N silent_mutation Average:62.554; most accessible tissue: Zhenshan97 young leaf, score: 74.675 N N N N
vg0704750780 G -> A LOC_Os07g09090.1 downstream_gene_variant ; 2514.0bp to feature; MODIFIER silent_mutation Average:62.554; most accessible tissue: Zhenshan97 young leaf, score: 74.675 N N N N
vg0704750780 G -> A LOC_Os07g09080.1 intron_variant ; MODIFIER silent_mutation Average:62.554; most accessible tissue: Zhenshan97 young leaf, score: 74.675 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704750780 NA 7.74E-26 mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 2.36E-22 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 1.10E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 3.08E-30 mr1204 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 4.02E-13 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 7.31E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 7.09E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 5.56E-06 mr1408 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 7.67E-28 mr1426 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 1.38E-28 mr1436 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 2.90E-09 mr1578 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 6.48E-13 mr1655 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 1.01E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 1.20E-40 mr1721 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 5.33E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 1.10E-06 mr1761 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 1.60E-10 mr1819 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 3.84E-07 NA mr1707_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 2.22E-06 NA mr1707_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 2.00E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704750780 NA 2.63E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251