\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704734352:

Variant ID: vg0704734352 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4734352
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCGGAGATACTTATACGAATTTTGCGGAAACCTGCAAACTTTGATGGACGATTGAGGCGAGTTTAGTTCTAAATTTTTTCTTCAAACTTCTAACTTTT[T/C]
CATCACATCGTTTCAATTTCAATCAAACTTCCAATGTTGACGTGAACTAAACACACCTATGAGATATGAGAAGCGGGTTGACACTTGACAAGTCCTGACA

Reverse complement sequence

TGTCAGGACTTGTCAAGTGTCAACCCGCTTCTCATATCTCATAGGTGTGTTTAGTTCACGTCAACATTGGAAGTTTGATTGAAATTGAAACGATGTGATG[A/G]
AAAAGTTAGAAGTTTGAAGAAAAAATTTAGAACTAAACTCGCCTCAATCGTCCATCAAAGTTTGCAGGTTTCCGCAAAATTCGTATAAGTATCTCCGGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.20% 21.70% 0.04% 0.00% NA
All Indica  2759 94.90% 5.10% 0.00% 0.00% NA
All Japonica  1512 43.50% 56.50% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.30% 7.70% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 93.50% 6.50% 0.00% 0.00% NA
Indica Intermediate  786 96.30% 3.70% 0.00% 0.00% NA
Temperate Japonica  767 10.00% 89.80% 0.13% 0.00% NA
Tropical Japonica  504 85.90% 14.10% 0.00% 0.00% NA
Japonica Intermediate  241 61.00% 39.00% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 9.40% 1.04% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704734352 T -> C LOC_Os07g09060.1 upstream_gene_variant ; 274.0bp to feature; MODIFIER silent_mutation Average:98.499; most accessible tissue: Zhenshan97 panicle, score: 99.569 N N N N
vg0704734352 T -> C LOC_Os07g09060.2 upstream_gene_variant ; 274.0bp to feature; MODIFIER silent_mutation Average:98.499; most accessible tissue: Zhenshan97 panicle, score: 99.569 N N N N
vg0704734352 T -> C LOC_Os07g09060.3 upstream_gene_variant ; 274.0bp to feature; MODIFIER silent_mutation Average:98.499; most accessible tissue: Zhenshan97 panicle, score: 99.569 N N N N
vg0704734352 T -> C LOC_Os07g09050.1 downstream_gene_variant ; 821.0bp to feature; MODIFIER silent_mutation Average:98.499; most accessible tissue: Zhenshan97 panicle, score: 99.569 N N N N
vg0704734352 T -> C LOC_Os07g09050.2 downstream_gene_variant ; 1969.0bp to feature; MODIFIER silent_mutation Average:98.499; most accessible tissue: Zhenshan97 panicle, score: 99.569 N N N N
vg0704734352 T -> C LOC_Os07g09050-LOC_Os07g09060 intergenic_region ; MODIFIER silent_mutation Average:98.499; most accessible tissue: Zhenshan97 panicle, score: 99.569 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0704734352 T C 0.01 0.01 0.01 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704734352 NA 4.64E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704734352 NA 2.25E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704734352 NA 6.78E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704734352 NA 6.23E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704734352 NA 3.06E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704734352 NA 2.80E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704734352 NA 4.55E-08 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704734352 NA 8.21E-07 mr1183_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704734352 NA 7.38E-07 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704734352 NA 1.03E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251