Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0704728125:

Variant ID: vg0704728125 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 4728125
Reference Allele: G	Alternative Allele: A,T
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATAAAAATTATAATCTTAACTTATACTTTTAGATATTTATACTAAACAGTCAAATAAAATGAATAGTTAAACGTTGTGCTAAAAAGTTAACGATGTCAG[G/A,T]
TACTCCCTCCATCCCATTTTAAATGTAGCCATATATTTTCGTGCTAAACTTTGATCGTTTGTCTTATTTAAAATTTTTTTAAACAATTAAAAAACATAAA

Reverse complement sequence

TTTATGTTTTTTAATTGTTTAAAAAAATTTTAAATAAGACAAACGATCAAAGTTTAGCACGAAAATATATGGCTACATTTAAAATGGGATGGAGGGAGTA[C/T,A]
CTGACATCGTTAACTTTTTAGCACAACGTTTAACTATTCATTTTATTTGACTGTTTAGTATAAATATCTAAAAGTATAAGTTAAGATTATAATTTTTATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.00%	8.90%	0.04%	0.00%	T: 0.08%
All Indica	2759	99.80%	0.10%	0.04%	0.00%	T: 0.04%
All Japonica	1512	73.30%	26.70%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.50%	0.13%	0.00%	T: 0.13%
Temperate Japonica	767	97.70%	2.20%	0.13%	0.00%	NA
Tropical Japonica	504	45.60%	54.40%	0.00%	0.00%	NA
Japonica Intermediate	241	53.50%	46.50%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	13.30%	0.00%	0.00%	T: 3.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0704728125	G -> A	LOC_Os07g09050.1	upstream_gene_variant ; 1341.0bp to feature; MODIFIER	silent_mutation	Average:28.891; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0704728125	G -> A	LOC_Os07g09050.2	upstream_gene_variant ; 1341.0bp to feature; MODIFIER	silent_mutation	Average:28.891; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0704728125	G -> A	LOC_Os07g09040.1	downstream_gene_variant ; 1101.0bp to feature; MODIFIER	silent_mutation	Average:28.891; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0704728125	G -> A	LOC_Os07g09040-LOC_Os07g09050	intergenic_region ; MODIFIER	silent_mutation	Average:28.891; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0704728125	G -> T	LOC_Os07g09050.1	upstream_gene_variant ; 1341.0bp to feature; MODIFIER	silent_mutation	Average:28.891; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0704728125	G -> T	LOC_Os07g09050.2	upstream_gene_variant ; 1341.0bp to feature; MODIFIER	silent_mutation	Average:28.891; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0704728125	G -> T	LOC_Os07g09040.1	downstream_gene_variant ; 1101.0bp to feature; MODIFIER	silent_mutation	Average:28.891; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0704728125	G -> T	LOC_Os07g09040-LOC_Os07g09050	intergenic_region ; MODIFIER	silent_mutation	Average:28.891; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0704728125	NA	7.58E-06	mr1509	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704728125	NA	1.85E-06	mr1363_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704728125	NA	3.06E-06	mr1509_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704728125	1.19E-06	NA	mr1563_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704728125	NA	5.10E-07	mr1623_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704728125	NA	5.61E-07	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251