\
| Variant ID: vg0704714916 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 4714916 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 336. )
AACGGCTCTTTTGACCTCGGGATGTCCGCTTGATCGAGCCAGGACGCCAGTTGTCTAGAGCCTAGGCGTTCACATATATGCCTATTGAGATAAGTGGGCA[C/G]
AAGTGACATCACGGGCATATCACCACCTGTCTTTCAAGATGAAAATTAATGAGTGCAAAATCAGTGAATCAAAAAGTAACATGAAACTCGATGGATTATT
AATAATCCATCGAGTTTCATGTTACTTTTTGATTCACTGATTTTGCACTCATTAATTTTCATCTTGAAAGACAGGTGGTGATATGCCCGTGATGTCACTT[G/C]
TGCCCACTTATCTCAATAGGCATATATGTGAACGCCTAGGCTCTAGACAACTGGCGTCCTGGCTCGATCAAGCGGACATCCCGAGGTCAAAAGAGCCGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.40% | 2.00% | 0.61% | 0.00% | NA |
| All Indica | 2759 | 95.60% | 3.40% | 0.98% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.70% | 10.40% | 2.86% | 0.00% | NA |
| Indica II | 465 | 97.80% | 1.50% | 0.65% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 3.30% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0704714916 | C -> G | LOC_Os07g09020.1 | upstream_gene_variant ; 2399.0bp to feature; MODIFIER | silent_mutation | Average:45.757; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
| vg0704714916 | C -> G | LOC_Os07g09030.1 | upstream_gene_variant ; 3727.0bp to feature; MODIFIER | silent_mutation | Average:45.757; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
| vg0704714916 | C -> G | LOC_Os07g09020-LOC_Os07g09030 | intergenic_region ; MODIFIER | silent_mutation | Average:45.757; most accessible tissue: Zhenshan97 young leaf, score: 75.751 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0704714916 | NA | 5.35E-06 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | 9.35E-06 | 9.34E-06 | mr1527 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | NA | 1.04E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | NA | 1.19E-06 | mr1156_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | NA | 5.29E-07 | mr1186_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | 5.72E-06 | 5.72E-06 | mr1284_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | NA | 1.65E-06 | mr1321_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | NA | 1.10E-06 | mr1358_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | 9.99E-06 | 2.31E-06 | mr1371_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | 3.65E-06 | 1.31E-09 | mr1378_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | NA | 3.26E-06 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | NA | 2.72E-06 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | NA | 8.02E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | NA | 2.95E-07 | mr1576_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | NA | 7.73E-08 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | 1.71E-06 | 1.17E-08 | mr1669_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | NA | 6.81E-07 | mr1682_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704714916 | NA | 1.40E-07 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |