Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0704714916:

Variant ID: vg0704714916 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 4714916
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:

AACGGCTCTTTTGACCTCGGGATGTCCGCTTGATCGAGCCAGGACGCCAGTTGTCTAGAGCCTAGGCGTTCACATATATGCCTATTGAGATAAGTGGGCA[C/G]
AAGTGACATCACGGGCATATCACCACCTGTCTTTCAAGATGAAAATTAATGAGTGCAAAATCAGTGAATCAAAAAGTAACATGAAACTCGATGGATTATT

Reverse complement sequence

AATAATCCATCGAGTTTCATGTTACTTTTTGATTCACTGATTTTGCACTCATTAATTTTCATCTTGAAAGACAGGTGGTGATATGCCCGTGATGTCACTT[G/C]
TGCCCACTTATCTCAATAGGCATATATGTGAACGCCTAGGCTCTAGACAACTGGCGTCCTGGCTCGATCAAGCGGACATCCCGAGGTCAAAAGAGCCGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.40%	2.00%	0.61%	0.00%	NA
All Indica	2759	95.60%	3.40%	0.98%	0.00%	NA
All Japonica	1512	99.90%	0.00%	0.13%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	86.70%	10.40%	2.86%	0.00%	NA
Indica II	465	97.80%	1.50%	0.65%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	95.80%	3.30%	0.89%	0.00%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0704714916	C -> G	LOC_Os07g09020.1	upstream_gene_variant ; 2399.0bp to feature; MODIFIER	silent_mutation	Average:45.757; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N
vg0704714916	C -> G	LOC_Os07g09030.1	upstream_gene_variant ; 3727.0bp to feature; MODIFIER	silent_mutation	Average:45.757; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N
vg0704714916	C -> G	LOC_Os07g09020-LOC_Os07g09030	intergenic_region ; MODIFIER	silent_mutation	Average:45.757; most accessible tissue: Zhenshan97 young leaf, score: 75.751	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0704714916	NA	5.35E-06	mr1125	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	9.35E-06	9.34E-06	mr1527	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	NA	1.04E-06	mr1002_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	NA	1.19E-06	mr1156_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	NA	5.29E-07	mr1186_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	5.72E-06	5.72E-06	mr1284_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	NA	1.65E-06	mr1321_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	NA	1.10E-06	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	9.99E-06	2.31E-06	mr1371_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	3.65E-06	1.31E-09	mr1378_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	NA	3.26E-06	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	NA	2.72E-06	mr1389_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	NA	8.02E-06	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	NA	2.95E-07	mr1576_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	NA	7.73E-08	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	1.71E-06	1.17E-08	mr1669_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	NA	6.81E-07	mr1682_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916	NA	1.40E-07	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251