\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704714916:

Variant ID: vg0704714916 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4714916
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 336. )

Flanking Sequence (100 bp) in Reference Genome:


AACGGCTCTTTTGACCTCGGGATGTCCGCTTGATCGAGCCAGGACGCCAGTTGTCTAGAGCCTAGGCGTTCACATATATGCCTATTGAGATAAGTGGGCA[C/G]
AAGTGACATCACGGGCATATCACCACCTGTCTTTCAAGATGAAAATTAATGAGTGCAAAATCAGTGAATCAAAAAGTAACATGAAACTCGATGGATTATT

Reverse complement sequence

AATAATCCATCGAGTTTCATGTTACTTTTTGATTCACTGATTTTGCACTCATTAATTTTCATCTTGAAAGACAGGTGGTGATATGCCCGTGATGTCACTT[G/C]
TGCCCACTTATCTCAATAGGCATATATGTGAACGCCTAGGCTCTAGACAACTGGCGTCCTGGCTCGATCAAGCGGACATCCCGAGGTCAAAAGAGCCGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.40% 2.00% 0.61% 0.00% NA
All Indica  2759 95.60% 3.40% 0.98% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 86.70% 10.40% 2.86% 0.00% NA
Indica II  465 97.80% 1.50% 0.65% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 95.80% 3.30% 0.89% 0.00% NA
Temperate Japonica  767 99.70% 0.00% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704714916 C -> G LOC_Os07g09020.1 upstream_gene_variant ; 2399.0bp to feature; MODIFIER silent_mutation Average:45.757; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N
vg0704714916 C -> G LOC_Os07g09030.1 upstream_gene_variant ; 3727.0bp to feature; MODIFIER silent_mutation Average:45.757; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N
vg0704714916 C -> G LOC_Os07g09020-LOC_Os07g09030 intergenic_region ; MODIFIER silent_mutation Average:45.757; most accessible tissue: Zhenshan97 young leaf, score: 75.751 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704714916 NA 5.35E-06 mr1125 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 9.35E-06 9.34E-06 mr1527 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 NA 1.04E-06 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 NA 1.19E-06 mr1156_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 NA 5.29E-07 mr1186_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 5.72E-06 5.72E-06 mr1284_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 NA 1.65E-06 mr1321_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 NA 1.10E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 9.99E-06 2.31E-06 mr1371_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 3.65E-06 1.31E-09 mr1378_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 NA 3.26E-06 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 NA 2.72E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 NA 8.02E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 NA 2.95E-07 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 NA 7.73E-08 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 1.71E-06 1.17E-08 mr1669_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 NA 6.81E-07 mr1682_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704714916 NA 1.40E-07 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251