\
| Variant ID: vg0704675216 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 4675216 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 236. )
GGACTACTCGGATTGTATCCATATTGGTTCCCTAGTTCTACTTGGACAAGGGGACACCTATGGGTATAAATACAAAGCCCTTTAGGAGGAGAGGGGACAC[G/A]
GAACAATAGATCAAGACACAAGATCAACATGCAAGCCAACATACGACAAGACAAGTGTTGGTATTTCTTAACGACATTATTAGAAATATAATTCCCAGCA
TGCTGGGAATTATATTTCTAATAATGTCGTTAAGAAATACCAACACTTGTCTTGTCGTATGTTGGCTTGCATGTTGATCTTGTGTCTTGATCTATTGTTC[C/T]
GTGTCCCCTCTCCTCCTAAAGGGCTTTGTATTTATACCCATAGGTGTCCCCTTGTCCAAGTAGAACTAGGGAACCAATATGGATACAATCCGAGTAGTCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.80% | 41.10% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 97.50% | 2.40% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 0.40% | 99.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 18.60% | 81.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 96.10% | 3.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.50% | 4.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.50% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.40% | 99.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 63.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0704675216 | G -> A | LOC_Os07g08990.1 | downstream_gene_variant ; 2589.0bp to feature; MODIFIER | silent_mutation | Average:45.994; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| vg0704675216 | G -> A | LOC_Os07g08970-LOC_Os07g08990 | intergenic_region ; MODIFIER | silent_mutation | Average:45.994; most accessible tissue: Zhenshan97 panicle, score: 59.59 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0704675216 | NA | 2.84E-36 | mr1064 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 6.03E-27 | mr1076 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 4.93E-50 | mr1078 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.43E-23 | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.12E-30 | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 6.57E-30 | mr1086 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 5.81E-62 | mr1088 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 4.01E-58 | mr1103 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 8.30E-34 | mr1104 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 3.57E-40 | mr1139 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 4.35E-28 | mr1145 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 2.74E-21 | mr1155 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.25E-31 | mr1204 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 8.15E-31 | mr1225 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 2.82E-31 | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 5.01E-61 | mr1246 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 6.17E-24 | mr1264 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.06E-25 | mr1411 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.98E-30 | mr1436 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 2.50E-41 | mr1437 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 9.69E-43 | mr1509 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 8.06E-41 | mr1534 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 4.49E-25 | mr1551 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 6.81E-48 | mr1558 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.04E-30 | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 2.59E-14 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.07E-61 | mr1671 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.53E-41 | mr1721 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 4.30E-30 | mr1737 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 2.38E-12 | mr1744 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 4.20E-31 | mr1793 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 2.63E-10 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 3.11E-08 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 2.28E-32 | mr1878 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.41E-15 | mr1916 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 5.56E-67 | mr1970 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.26E-84 | mr1973 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.05E-63 | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 3.42E-48 | mr1070_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 8.99E-36 | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 7.34E-85 | mr1088_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 7.27E-45 | mr1094_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 9.28E-60 | mr1096_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.05E-67 | mr1103_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 3.40E-38 | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.24E-54 | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 2.03E-56 | mr1109_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 9.11E-50 | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.97E-61 | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 4.17E-52 | mr1121_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 3.28E-37 | mr1129_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 6.09E-19 | mr1131_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.56E-50 | mr1144_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 4.65E-45 | mr1145_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 2.00E-14 | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 3.01E-19 | mr1199_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 2.19E-54 | mr1200_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 3.37E-38 | mr1224_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 5.15E-42 | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 4.05E-75 | mr1246_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 7.20E-21 | mr1253_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.19E-19 | mr1255_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 5.26E-41 | mr1264_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.52E-27 | mr1270_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 3.54E-23 | mr1316_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.42E-50 | mr1404_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 2.21E-48 | mr1437_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 3.14E-46 | mr1458_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.68E-50 | mr1509_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 3.91E-23 | mr1551_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 8.17E-63 | mr1558_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.48E-31 | mr1598_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 4.99E-22 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.49E-49 | mr1620_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.47E-77 | mr1671_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 9.79E-15 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 2.39E-52 | mr1721_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.76E-15 | mr1744_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 9.75E-50 | mr1793_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 6.13E-70 | mr1798_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 6.06E-39 | mr1878_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 2.45E-31 | mr1913_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 5.71E-25 | mr1916_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 1.62E-66 | mr1970_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704675216 | NA | 2.43E-103 | mr1973_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |