Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704638640:

Variant ID: vg0704638640 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 4638640
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACTTATATACTCTCTCCGTTCCAAAATATAACAACTCCAAAATATAACAACTTCTAGCTCATAAGATTTGTCTTAAAATATAATAGCTTTTTCACCAAC[G/A]
TTCTCTTCTCTACAATTATGACCATGTACCATTCATTTTCTCACATGTCTTCACTTTTCAACCAATCATAACATTATCCTATTTAATTATACCTACTTTC

Reverse complement sequence

GAAAGTAGGTATAATTAAATAGGATAATGTTATGATTGGTTGAAAAGTGAAGACATGTGAGAAAATGAATGGTACATGGTCATAATTGTAGAGAAGAGAA[C/T]
GTTGGTGAAAAAGCTATTATATTTTAAGACAAATCTTATGAGCTAGAAGTTGTTATATTTTGGAGTTGTTATATTTTGGAACGGAGAGAGTATATAAGTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.20%	18.70%	0.11%	0.00%	NA
All Indica	2759	98.40%	1.60%	0.07%	0.00%	NA
All Japonica	1512	64.80%	35.10%	0.13%	0.00%	NA
Aus	269	25.30%	74.70%	0.00%	0.00%	NA
Indica I	595	99.70%	0.20%	0.17%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	98.70%	1.30%	0.00%	0.00%	NA
Indica Intermediate	786	96.70%	3.20%	0.13%	0.00%	NA
Temperate Japonica	767	57.00%	42.90%	0.13%	0.00%	NA
Tropical Japonica	504	75.80%	24.20%	0.00%	0.00%	NA
Japonica Intermediate	241	66.80%	32.80%	0.41%	0.00%	NA
VI/Aromatic	96	16.70%	83.30%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0704638640	G -> A	LOC_Os07g08910.1	upstream_gene_variant ; 3894.0bp to feature; MODIFIER	silent_mutation	Average:49.199; most accessible tissue: Zhenshan97 flower, score: 74.953	N	N	N	N
vg0704638640	G -> A	LOC_Os07g08920.1	upstream_gene_variant ; 1129.0bp to feature; MODIFIER	silent_mutation	Average:49.199; most accessible tissue: Zhenshan97 flower, score: 74.953	N	N	N	N
vg0704638640	G -> A	LOC_Os07g08930.1	upstream_gene_variant ; 3869.0bp to feature; MODIFIER	silent_mutation	Average:49.199; most accessible tissue: Zhenshan97 flower, score: 74.953	N	N	N	N
vg0704638640	G -> A	LOC_Os07g08920-LOC_Os07g08930	intergenic_region ; MODIFIER	silent_mutation	Average:49.199; most accessible tissue: Zhenshan97 flower, score: 74.953	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0704638640	NA	3.50E-07	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640	7.08E-08	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640	NA	6.63E-07	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640	4.66E-08	NA	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640	4.57E-06	1.24E-08	mr1309	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640	NA	1.42E-06	mr1415	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640	5.80E-07	NA	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640	NA	9.36E-07	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640	NA	1.42E-06	mr1567	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640	NA	3.09E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640	NA	2.66E-06	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640	7.86E-07	NA	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640	NA	7.18E-08	mr1900	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251