\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704638640:

Variant ID: vg0704638640 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4638640
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACTTATATACTCTCTCCGTTCCAAAATATAACAACTCCAAAATATAACAACTTCTAGCTCATAAGATTTGTCTTAAAATATAATAGCTTTTTCACCAAC[G/A]
TTCTCTTCTCTACAATTATGACCATGTACCATTCATTTTCTCACATGTCTTCACTTTTCAACCAATCATAACATTATCCTATTTAATTATACCTACTTTC

Reverse complement sequence

GAAAGTAGGTATAATTAAATAGGATAATGTTATGATTGGTTGAAAAGTGAAGACATGTGAGAAAATGAATGGTACATGGTCATAATTGTAGAGAAGAGAA[C/T]
GTTGGTGAAAAAGCTATTATATTTTAAGACAAATCTTATGAGCTAGAAGTTGTTATATTTTGGAGTTGTTATATTTTGGAACGGAGAGAGTATATAAGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 18.70% 0.11% 0.00% NA
All Indica  2759 98.40% 1.60% 0.07% 0.00% NA
All Japonica  1512 64.80% 35.10% 0.13% 0.00% NA
Aus  269 25.30% 74.70% 0.00% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.20% 0.13% 0.00% NA
Temperate Japonica  767 57.00% 42.90% 0.13% 0.00% NA
Tropical Japonica  504 75.80% 24.20% 0.00% 0.00% NA
Japonica Intermediate  241 66.80% 32.80% 0.41% 0.00% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 65.60% 33.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704638640 G -> A LOC_Os07g08910.1 upstream_gene_variant ; 3894.0bp to feature; MODIFIER silent_mutation Average:49.199; most accessible tissue: Zhenshan97 flower, score: 74.953 N N N N
vg0704638640 G -> A LOC_Os07g08920.1 upstream_gene_variant ; 1129.0bp to feature; MODIFIER silent_mutation Average:49.199; most accessible tissue: Zhenshan97 flower, score: 74.953 N N N N
vg0704638640 G -> A LOC_Os07g08930.1 upstream_gene_variant ; 3869.0bp to feature; MODIFIER silent_mutation Average:49.199; most accessible tissue: Zhenshan97 flower, score: 74.953 N N N N
vg0704638640 G -> A LOC_Os07g08920-LOC_Os07g08930 intergenic_region ; MODIFIER silent_mutation Average:49.199; most accessible tissue: Zhenshan97 flower, score: 74.953 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704638640 NA 3.50E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640 7.08E-08 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640 NA 6.63E-07 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640 4.66E-08 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640 4.57E-06 1.24E-08 mr1309 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640 NA 1.42E-06 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640 5.80E-07 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640 NA 9.36E-07 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640 NA 1.42E-06 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640 NA 3.09E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640 NA 2.66E-06 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640 7.86E-07 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704638640 NA 7.18E-08 mr1900 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251