\
| Variant ID: vg0704635310 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 4635310 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 103. )
TTCATCGGACTTCGAAACCAGCTATCTCAGCTGAGATTACCAGGGGATCTTGATGCAGGAACATAACTCCTTCTGCGTCTTCCGGCCCAAAAGAAATTAG[T/C]
TGGTTCAGATACTGCGGCGCCCCTTCACCCGCCGAAGTGATGCTGTGGACCATACGGGTCTGCATCTTCTTCTGCCGTTTGGACAACTGGCTTGGCGGGT
ACCCGCCAAGCCAGTTGTCCAAACGGCAGAAGAAGATGCAGACCCGTATGGTCCACAGCATCACTTCGGCGGGTGAAGGGGCGCCGCAGTATCTGAACCA[A/G]
CTAATTTCTTTTGGGCCGGAAGACGCAGAAGGAGTTATGTTCCTGCATCAAGATCCCCTGGTAATCTCAGCTGAGATAGCTGGTTTCGAAGTCCGATGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.80% | 24.30% | 30.94% | 0.02% | NA |
| All Indica | 2759 | 38.80% | 10.70% | 50.45% | 0.04% | NA |
| All Japonica | 1512 | 64.20% | 35.40% | 0.40% | 0.00% | NA |
| Aus | 269 | 8.60% | 75.10% | 16.36% | 0.00% | NA |
| Indica I | 595 | 23.40% | 7.70% | 68.91% | 0.00% | NA |
| Indica II | 465 | 36.80% | 11.40% | 51.83% | 0.00% | NA |
| Indica III | 913 | 50.20% | 12.20% | 37.68% | 0.00% | NA |
| Indica Intermediate | 786 | 38.40% | 10.90% | 50.51% | 0.13% | NA |
| Temperate Japonica | 767 | 56.50% | 43.00% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 75.00% | 24.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 66.00% | 33.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 15.60% | 83.30% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 36.70% | 21.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0704635310 | T -> DEL | N | N | silent_mutation | Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0704635310 | T -> C | LOC_Os07g08910.1 | upstream_gene_variant ; 564.0bp to feature; MODIFIER | silent_mutation | Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0704635310 | T -> C | LOC_Os07g08900.1 | downstream_gene_variant ; 4351.0bp to feature; MODIFIER | silent_mutation | Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0704635310 | T -> C | LOC_Os07g08920.1 | downstream_gene_variant ; 468.0bp to feature; MODIFIER | silent_mutation | Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg0704635310 | T -> C | LOC_Os07g08910-LOC_Os07g08920 | intergenic_region ; MODIFIER | silent_mutation | Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0704635310 | 1.53E-07 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704635310 | NA | 1.56E-06 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704635310 | 2.19E-07 | NA | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704635310 | 3.04E-06 | 2.31E-08 | mr1309 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704635310 | 2.60E-09 | NA | mr1484 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704635310 | NA | 5.22E-07 | mr1484 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704635310 | NA | 2.24E-06 | mr1841 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704635310 | NA | 1.29E-07 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704635310 | 1.77E-06 | NA | mr1945 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |