\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704635310:

Variant ID: vg0704635310 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4635310
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTCATCGGACTTCGAAACCAGCTATCTCAGCTGAGATTACCAGGGGATCTTGATGCAGGAACATAACTCCTTCTGCGTCTTCCGGCCCAAAAGAAATTAG[T/C]
TGGTTCAGATACTGCGGCGCCCCTTCACCCGCCGAAGTGATGCTGTGGACCATACGGGTCTGCATCTTCTTCTGCCGTTTGGACAACTGGCTTGGCGGGT

Reverse complement sequence

ACCCGCCAAGCCAGTTGTCCAAACGGCAGAAGAAGATGCAGACCCGTATGGTCCACAGCATCACTTCGGCGGGTGAAGGGGCGCCGCAGTATCTGAACCA[A/G]
CTAATTTCTTTTGGGCCGGAAGACGCAGAAGGAGTTATGTTCCTGCATCAAGATCCCCTGGTAATCTCAGCTGAGATAGCTGGTTTCGAAGTCCGATGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.80% 24.30% 30.94% 0.02% NA
All Indica  2759 38.80% 10.70% 50.45% 0.04% NA
All Japonica  1512 64.20% 35.40% 0.40% 0.00% NA
Aus  269 8.60% 75.10% 16.36% 0.00% NA
Indica I  595 23.40% 7.70% 68.91% 0.00% NA
Indica II  465 36.80% 11.40% 51.83% 0.00% NA
Indica III  913 50.20% 12.20% 37.68% 0.00% NA
Indica Intermediate  786 38.40% 10.90% 50.51% 0.13% NA
Temperate Japonica  767 56.50% 43.00% 0.52% 0.00% NA
Tropical Japonica  504 75.00% 24.80% 0.20% 0.00% NA
Japonica Intermediate  241 66.00% 33.60% 0.41% 0.00% NA
VI/Aromatic  96 15.60% 83.30% 1.04% 0.00% NA
Intermediate  90 42.20% 36.70% 21.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704635310 T -> DEL N N silent_mutation Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0704635310 T -> C LOC_Os07g08910.1 upstream_gene_variant ; 564.0bp to feature; MODIFIER silent_mutation Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0704635310 T -> C LOC_Os07g08900.1 downstream_gene_variant ; 4351.0bp to feature; MODIFIER silent_mutation Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0704635310 T -> C LOC_Os07g08920.1 downstream_gene_variant ; 468.0bp to feature; MODIFIER silent_mutation Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg0704635310 T -> C LOC_Os07g08910-LOC_Os07g08920 intergenic_region ; MODIFIER silent_mutation Average:22.285; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704635310 1.53E-07 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310 NA 1.56E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310 2.19E-07 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310 3.04E-06 2.31E-08 mr1309 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310 2.60E-09 NA mr1484 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310 NA 5.22E-07 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310 NA 2.24E-06 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310 NA 1.29E-07 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704635310 1.77E-06 NA mr1945 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251