Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0704634433:

Variant ID: vg0704634433 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 4634433
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

GATTCGCGGCAAGGGGAAGTCGTCTTTTGGACACGCTTTGTTCAGGTCTGTGAAATCGACACACATGCGCCATTTGTCGTTCGACTTCCGCACCAGCACT[A/G]
GATTCACCAACCACTCCAGATGGTCAATCTCTTAGATAACCCCCGCCCTGAGCAATTTTTGTACTTCGGCTTTCGCCGCTTCTTGGCGATCGGCAGACAT

Reverse complement sequence

ATGTCTGCCGATCGCCAAGAAGCGGCGAAAGCCGAAGTACAAAAATTGCTCAGGGCGGGGGTTATCTAAGAGATTGACCATCTGGAGTGGTTGGTGAATC[T/C]
AGTGCTGGTGCGGAAGTCGAACGACAAATGGCGCATGTGTGTCGATTTCACAGACCTGAACAAAGCGTGTCCAAAAGACGACTTCCCCTTGCCGCGAATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	22.00%	19.70%	14.62%	43.67%	NA
All Indica	2759	0.80%	2.90%	23.67%	72.56%	NA
All Japonica	1512	64.50%	35.10%	0.20%	0.26%	NA
Aus	269	0.40%	76.60%	7.81%	15.24%	NA
Indica I	595	0.50%	0.70%	11.26%	87.56%	NA
Indica II	465	2.20%	1.90%	15.91%	80.00%	NA
Indica III	913	0.40%	2.10%	33.73%	63.75%	NA
Indica Intermediate	786	0.80%	6.20%	25.95%	67.05%	NA
Temperate Japonica	767	56.70%	42.80%	0.26%	0.26%	NA
Tropical Japonica	504	75.60%	24.00%	0.20%	0.20%	NA
Japonica Intermediate	241	66.00%	33.60%	0.00%	0.41%	NA
VI/Aromatic	96	15.60%	83.30%	0.00%	1.04%	NA
Intermediate	90	28.90%	37.80%	15.56%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0704634433	A -> DEL	N	N	silent_mutation	Average:15.101; most accessible tissue: Minghui63 root, score: 19.68	N	N	N	N
vg0704634433	A -> G	LOC_Os07g08900.1	downstream_gene_variant ; 3474.0bp to feature; MODIFIER	silent_mutation	Average:15.101; most accessible tissue: Minghui63 root, score: 19.68	N	N	N	N
vg0704634433	A -> G	LOC_Os07g08920.1	downstream_gene_variant ; 1345.0bp to feature; MODIFIER	silent_mutation	Average:15.101; most accessible tissue: Minghui63 root, score: 19.68	N	N	N	N
vg0704634433	A -> G	LOC_Os07g08910.1	intron_variant ; MODIFIER	silent_mutation	Average:15.101; most accessible tissue: Minghui63 root, score: 19.68	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0704634433	2.14E-08	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704634433	NA	3.61E-06	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704634433	1.37E-08	NA	mr1309	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704634433	7.53E-06	5.09E-08	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704634433	3.42E-07	NA	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704634433	NA	1.87E-06	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704634433	5.79E-06	NA	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704634433	NA	7.99E-06	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704634433	4.22E-07	NA	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704634433	NA	2.52E-07	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251