\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704627367:

Variant ID: vg0704627367 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4627367
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


CACTTGCCATTTTTACTGCGTGCGCTCTCTTCTTCTGTTCCCCTCTTCCACAGCATTTCTTGACCCCTCAGGTGTTTCACCCATTATCTTCCTTCGCCAC[T/C]
GCATACACGCCGTTTGCCATGGCCCCTCGCAAGCCAAACCCAGCTTCGGCAAAAGGACCGGATCCCGGCCGGGTCGATGATGACAGCACCGCCTTTTTGG

Reverse complement sequence

CCAAAAAGGCGGTGCTGTCATCATCGACCCGGCCGGGATCCGGTCCTTTTGCCGAAGCTGGGTTTGGCTTGCGAGGGGCCATGGCAAACGGCGTGTATGC[A/G]
GTGGCGAAGGAAGATAATGGGTGAAACACCTGAGGGGTCAAGAAATGCTGTGGAAGAGGGGAACAGAAGAAGAGAGCGCACGCAGTAAAAATGGCAAGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.90% 19.50% 25.65% 32.95% NA
All Indica  2759 1.10% 2.50% 41.50% 54.87% NA
All Japonica  1512 63.90% 35.20% 0.46% 0.46% NA
Aus  269 0.00% 77.30% 16.36% 6.32% NA
Indica I  595 1.00% 0.80% 21.51% 76.64% NA
Indica II  465 2.20% 2.20% 32.26% 63.44% NA
Indica III  913 0.50% 2.10% 62.98% 34.39% NA
Indica Intermediate  786 1.30% 4.50% 37.15% 57.12% NA
Temperate Japonica  767 55.70% 42.90% 0.78% 0.65% NA
Tropical Japonica  504 75.60% 24.00% 0.20% 0.20% NA
Japonica Intermediate  241 65.60% 34.00% 0.00% 0.41% NA
VI/Aromatic  96 15.60% 83.30% 1.04% 0.00% NA
Intermediate  90 26.70% 35.60% 16.67% 21.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704627367 T -> DEL N N silent_mutation Average:24.296; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg0704627367 T -> C LOC_Os07g08900.1 upstream_gene_variant ; 19.0bp to feature; MODIFIER silent_mutation Average:24.296; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg0704627367 T -> C LOC_Os07g08890.1 downstream_gene_variant ; 4554.0bp to feature; MODIFIER silent_mutation Average:24.296; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg0704627367 T -> C LOC_Os07g08910.1 downstream_gene_variant ; 4181.0bp to feature; MODIFIER silent_mutation Average:24.296; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N
vg0704627367 T -> C LOC_Os07g08890-LOC_Os07g08900 intergenic_region ; MODIFIER silent_mutation Average:24.296; most accessible tissue: Minghui63 young leaf, score: 39.381 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704627367 1.39E-09 2.58E-32 mr1238 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 NA 2.40E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 1.44E-10 8.69E-34 mr1309 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 5.72E-06 3.14E-08 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 5.51E-09 1.14E-22 mr1484 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 NA 1.32E-06 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 1.47E-06 5.14E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 NA 5.19E-06 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 5.27E-07 1.98E-17 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 NA 2.29E-07 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 NA 2.12E-11 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 NA 2.13E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 1.72E-06 2.09E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 4.40E-07 6.25E-27 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 NA 3.63E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367 NA 1.90E-19 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251