Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704627367:

Variant ID: vg0704627367 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 4627367
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

CACTTGCCATTTTTACTGCGTGCGCTCTCTTCTTCTGTTCCCCTCTTCCACAGCATTTCTTGACCCCTCAGGTGTTTCACCCATTATCTTCCTTCGCCAC[T/C]
GCATACACGCCGTTTGCCATGGCCCCTCGCAAGCCAAACCCAGCTTCGGCAAAAGGACCGGATCCCGGCCGGGTCGATGATGACAGCACCGCCTTTTTGG

Reverse complement sequence

CCAAAAAGGCGGTGCTGTCATCATCGACCCGGCCGGGATCCGGTCCTTTTGCCGAAGCTGGGTTTGGCTTGCGAGGGGCCATGGCAAACGGCGTGTATGC[A/G]
GTGGCGAAGGAAGATAATGGGTGAAACACCTGAGGGGTCAAGAAATGCTGTGGAAGAGGGGAACAGAAGAAGAGAGCGCACGCAGTAAAAATGGCAAGTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.90%	19.50%	25.65%	32.95%	NA
All Indica	2759	1.10%	2.50%	41.50%	54.87%	NA
All Japonica	1512	63.90%	35.20%	0.46%	0.46%	NA
Aus	269	0.00%	77.30%	16.36%	6.32%	NA
Indica I	595	1.00%	0.80%	21.51%	76.64%	NA
Indica II	465	2.20%	2.20%	32.26%	63.44%	NA
Indica III	913	0.50%	2.10%	62.98%	34.39%	NA
Indica Intermediate	786	1.30%	4.50%	37.15%	57.12%	NA
Temperate Japonica	767	55.70%	42.90%	0.78%	0.65%	NA
Tropical Japonica	504	75.60%	24.00%	0.20%	0.20%	NA
Japonica Intermediate	241	65.60%	34.00%	0.00%	0.41%	NA
VI/Aromatic	96	15.60%	83.30%	1.04%	0.00%	NA
Intermediate	90	26.70%	35.60%	16.67%	21.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0704627367	T -> DEL	N	N	silent_mutation	Average:24.296; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N
vg0704627367	T -> C	LOC_Os07g08900.1	upstream_gene_variant ; 19.0bp to feature; MODIFIER	silent_mutation	Average:24.296; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N
vg0704627367	T -> C	LOC_Os07g08890.1	downstream_gene_variant ; 4554.0bp to feature; MODIFIER	silent_mutation	Average:24.296; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N
vg0704627367	T -> C	LOC_Os07g08910.1	downstream_gene_variant ; 4181.0bp to feature; MODIFIER	silent_mutation	Average:24.296; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N
vg0704627367	T -> C	LOC_Os07g08890-LOC_Os07g08900	intergenic_region ; MODIFIER	silent_mutation	Average:24.296; most accessible tissue: Minghui63 young leaf, score: 39.381	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0704627367	1.39E-09	2.58E-32	mr1238	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	NA	2.40E-06	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	1.44E-10	8.69E-34	mr1309	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	5.72E-06	3.14E-08	mr1309	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	5.51E-09	1.14E-22	mr1484	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	NA	1.32E-06	mr1484	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	1.47E-06	5.14E-23	mr1841	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	NA	5.19E-06	mr1841	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	5.27E-07	1.98E-17	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	NA	2.29E-07	mr1900	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	NA	2.12E-11	mr1945	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	NA	2.13E-11	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	1.72E-06	2.09E-28	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	4.40E-07	6.25E-27	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	NA	3.63E-20	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704627367	NA	1.90E-19	mr1945_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251