\
| Variant ID: vg0704618174 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 4618174 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CATATAATGTTTCTACGACCGAGATTGCGATAGGCCTATATTAATTATCCGAGTACTAATACGTCGAATGAGGTACAAAATAATACCTCACTTAACATAT[G/A]
AAATTGCGCAACAACCAACTTCAATACATTTTTATAACAATATTAACAAGTTTTACCAATAAATACTTCTTTATTTATTATTAACATAACATAGAAAAAT
ATTTTTCTATGTTATGTTAATAATAAATAAAGAAGTATTTATTGGTAAAACTTGTTAATATTGTTATAAAAATGTATTGAAGTTGGTTGTTGCGCAATTT[C/T]
ATATGTTAAGTGAGGTATTATTTTGTACCTCATTCGACGTATTAGTACTCGGATAATTAATATAGGCCTATCGCAATCTCGGTCGTAGAAACATTATATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.80% | 32.70% | 0.21% | 11.26% | NA |
| All Indica | 2759 | 92.50% | 2.30% | 0.04% | 5.15% | NA |
| All Japonica | 1512 | 0.50% | 74.50% | 0.40% | 24.54% | NA |
| Aus | 269 | 16.40% | 83.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 86.40% | 0.70% | 0.00% | 12.94% | NA |
| Indica II | 465 | 97.20% | 2.40% | 0.00% | 0.43% | NA |
| Indica III | 913 | 95.60% | 1.60% | 0.00% | 2.74% | NA |
| Indica Intermediate | 786 | 90.70% | 4.30% | 0.13% | 4.83% | NA |
| Temperate Japonica | 767 | 0.70% | 55.50% | 0.52% | 43.29% | NA |
| Tropical Japonica | 504 | 0.40% | 96.80% | 0.40% | 2.38% | NA |
| Japonica Intermediate | 241 | 0.40% | 88.40% | 0.00% | 11.20% | NA |
| VI/Aromatic | 96 | 1.00% | 83.30% | 2.08% | 13.54% | NA |
| Intermediate | 90 | 36.70% | 55.60% | 1.11% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0704618174 | G -> DEL | N | N | silent_mutation | Average:35.908; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0704618174 | G -> A | LOC_Os07g08890.1 | upstream_gene_variant ; 492.0bp to feature; MODIFIER | silent_mutation | Average:35.908; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0704618174 | G -> A | LOC_Os07g08880.1 | downstream_gene_variant ; 3575.0bp to feature; MODIFIER | silent_mutation | Average:35.908; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0704618174 | G -> A | LOC_Os07g08880.2 | downstream_gene_variant ; 3576.0bp to feature; MODIFIER | silent_mutation | Average:35.908; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0704618174 | G -> A | LOC_Os07g08880.3 | downstream_gene_variant ; 3575.0bp to feature; MODIFIER | silent_mutation | Average:35.908; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0704618174 | G -> A | LOC_Os07g08880-LOC_Os07g08890 | intergenic_region ; MODIFIER | silent_mutation | Average:35.908; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0704618174 | NA | 1.22E-07 | mr1045 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 2.39E-06 | mr1058 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 1.33E-23 | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 3.42E-07 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 2.89E-06 | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 6.05E-14 | mr1138 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 2.78E-07 | mr1138 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 1.91E-06 | mr1176 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 2.21E-12 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 9.52E-12 | mr1233 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 3.11E-13 | mr1270 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 8.80E-10 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 2.16E-10 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 6.98E-06 | mr1398 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 1.58E-28 | mr1436 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 7.15E-06 | mr1436 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 7.74E-07 | mr1560 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 9.50E-06 | mr1568 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 3.31E-11 | mr1578 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 1.35E-13 | mr1655 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 3.09E-06 | mr1661 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 3.70E-10 | mr1663 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 9.01E-17 | mr1700 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 1.14E-07 | mr1716 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | 3.31E-07 | NA | mr1728 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | 9.77E-07 | 1.41E-08 | mr1728 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 1.33E-06 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 9.35E-12 | mr1819 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704618174 | NA | 2.14E-06 | mr1860 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |