\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704603367:

Variant ID: vg0704603367 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4603367
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGTTGCACTAACTGTAATCTTTTTACTTATGGCAATAAAATGTTTACCTGATTCATTTACTTGCGCCGTGTTTAGTTCCAAAATAATTCTTCAAACTT[T/C]
CAACTTTTCCATCACATCAAAACTTTCCTACACACATAAACTTCTAACTTTTCTGTCACATCGTTCCAATTTCAACCAAACTTCCAATTTTGGCGTGAAC

Reverse complement sequence

GTTCACGCCAAAATTGGAAGTTTGGTTGAAATTGGAACGATGTGACAGAAAAGTTAGAAGTTTATGTGTGTAGGAAAGTTTTGATGTGATGGAAAAGTTG[A/G]
AAGTTTGAAGAATTATTTTGGAACTAAACACGGCGCAAGTAAATGAATCAGGTAAACATTTTATTGCCATAAGTAAAAAGATTACAGTTAGTGCAACCTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 32.40% 0.06% 0.00% NA
All Indica  2759 97.30% 2.70% 0.00% 0.00% NA
All Japonica  1512 25.60% 74.30% 0.07% 0.00% NA
Aus  269 23.40% 76.60% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 98.40% 1.60% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 4.60% 0.00% 0.00% NA
Temperate Japonica  767 44.60% 55.40% 0.00% 0.00% NA
Tropical Japonica  504 3.20% 96.60% 0.20% 0.00% NA
Japonica Intermediate  241 12.00% 88.00% 0.00% 0.00% NA
VI/Aromatic  96 16.70% 83.30% 0.00% 0.00% NA
Intermediate  90 45.60% 52.20% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704603367 T -> C LOC_Os07g08880.1 upstream_gene_variant ; 3312.0bp to feature; MODIFIER silent_mutation Average:53.579; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0704603367 T -> C LOC_Os07g08880.4 upstream_gene_variant ; 3312.0bp to feature; MODIFIER silent_mutation Average:53.579; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0704603367 T -> C LOC_Os07g08880.2 upstream_gene_variant ; 3312.0bp to feature; MODIFIER silent_mutation Average:53.579; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0704603367 T -> C LOC_Os07g08880.3 upstream_gene_variant ; 3312.0bp to feature; MODIFIER silent_mutation Average:53.579; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0704603367 T -> C LOC_Os07g08870-LOC_Os07g08880 intergenic_region ; MODIFIER silent_mutation Average:53.579; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704603367 5.00E-06 5.00E-06 mr1447 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251