\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704572014:

Variant ID: vg0704572014 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4572014
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAAACGCAGGAATTGGATGAGAGAGATAGACTCAAAGAAAAGTTACCAAGAGGTTGAAGCTCTTGCTAAATTTCCTCCAAAATCTCTATAGGATTGTC[C/T]
ATTCCATAAGAATTTCAAAGGATTGGATAGAATTCAATCCTTTATTTCAAAGGGCTTCATAGAAAATTTTCCTATAGAATTGGAATCATCCAAAATTCCT

Reverse complement sequence

AGGAATTTTGGATGATTCCAATTCTATAGGAAAATTTTCTATGAAGCCCTTTGAAATAAAGGATTGAATTCTATCCAATCCTTTGAAATTCTTATGGAAT[G/A]
GACAATCCTATAGAGATTTTGGAGGAAATTTAGCAAGAGCTTCAACCTCTTGGTAACTTTTCTTTGAGTCTATCTCTCTCATCCAATTCCTGCGTTTTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.30% 12.60% 0.06% 0.00% NA
All Indica  2759 98.50% 1.40% 0.07% 0.00% NA
All Japonica  1512 84.80% 15.10% 0.07% 0.00% NA
Aus  269 13.00% 87.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.40% 0.13% 0.00% NA
Temperate Japonica  767 93.90% 6.00% 0.13% 0.00% NA
Tropical Japonica  504 68.80% 31.20% 0.00% 0.00% NA
Japonica Intermediate  241 89.20% 10.80% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 81.20% 0.00% 0.00% NA
Intermediate  90 81.10% 18.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704572014 C -> T LOC_Os07g08840.1 downstream_gene_variant ; 2231.0bp to feature; MODIFIER silent_mutation Average:59.997; most accessible tissue: Zhenshan97 flag leaf, score: 92.31 N N N N
vg0704572014 C -> T LOC_Os07g08840.2 downstream_gene_variant ; 2231.0bp to feature; MODIFIER silent_mutation Average:59.997; most accessible tissue: Zhenshan97 flag leaf, score: 92.31 N N N N
vg0704572014 C -> T LOC_Os07g08840.3 downstream_gene_variant ; 2231.0bp to feature; MODIFIER silent_mutation Average:59.997; most accessible tissue: Zhenshan97 flag leaf, score: 92.31 N N N N
vg0704572014 C -> T LOC_Os07g08820-LOC_Os07g08840 intergenic_region ; MODIFIER silent_mutation Average:59.997; most accessible tissue: Zhenshan97 flag leaf, score: 92.31 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0704572014 C T 0.01 -0.02 -0.02 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704572014 NA 2.50E-07 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704572014 5.56E-07 NA mr1080 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704572014 9.76E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704572014 4.02E-06 NA mr1203 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704572014 5.42E-06 NA mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704572014 NA 4.99E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704572014 NA 7.33E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704572014 NA 1.15E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704572014 NA 7.29E-19 mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251