Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704257453:

Variant ID: vg0704257453 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 4257453
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.00, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:

AGTTTCAGTCTTATTAGAGTCACAAAACCACCATATGCATATGATATGATCTCTATAAAAGCTAAGTGGATGACACACATAGGCAGTATGTTGGAGAGAG[A/G]
GGGAGAGAGAGACCTGCATATCTTTCTCATCTGGATCATTCAATGGTTCAGCCCATGCAACTCTTATATTCAGGCCTTTGCCAAAAGCATTTTTCTGTGA

Reverse complement sequence

TCACAGAAAAATGCTTTTGGCAAAGGCCTGAATATAAGAGTTGCATGGGCTGAACCATTGAATGATCCAGATGAGAAAGATATGCAGGTCTCTCTCTCCC[T/C]
CTCTCTCCAACATACTGCCTATGTGTGTCATCCACTTAGCTTTTATAGAGATCATATCATATGCATATGGTGGTTTTGTGACTCTAATAAGACTGAAACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.20%	0.80%	14.71%	3.24%	NA
All Indica	2759	68.30%	1.40%	24.86%	5.44%	NA
All Japonica	1512	99.90%	0.10%	0.07%	0.00%	NA
Aus	269	99.30%	0.00%	0.74%	0.00%	NA
Indica I	595	63.50%	1.80%	30.42%	4.20%	NA
Indica II	465	64.10%	0.90%	29.46%	5.59%	NA
Indica III	913	71.60%	0.90%	21.03%	6.46%	NA
Indica Intermediate	786	70.60%	1.90%	22.39%	5.09%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.20%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	90.00%	0.00%	6.67%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0704257453	A -> DEL	N	N	silent_mutation	Average:53.104; most accessible tissue: Callus, score: 82.525	N	N	N	N
vg0704257453	A -> G	LOC_Os07g08300.2	downstream_gene_variant ; 3956.0bp to feature; MODIFIER	silent_mutation	Average:53.104; most accessible tissue: Callus, score: 82.525	N	N	N	N
vg0704257453	A -> G	LOC_Os07g08300.1	downstream_gene_variant ; 4046.0bp to feature; MODIFIER	silent_mutation	Average:53.104; most accessible tissue: Callus, score: 82.525	N	N	N	N
vg0704257453	A -> G	LOC_Os07g08300.3	downstream_gene_variant ; 4042.0bp to feature; MODIFIER	silent_mutation	Average:53.104; most accessible tissue: Callus, score: 82.525	N	N	N	N
vg0704257453	A -> G	LOC_Os07g08300.4	downstream_gene_variant ; 4042.0bp to feature; MODIFIER	silent_mutation	Average:53.104; most accessible tissue: Callus, score: 82.525	N	N	N	N
vg0704257453	A -> G	LOC_Os07g08300.5	downstream_gene_variant ; 4042.0bp to feature; MODIFIER	silent_mutation	Average:53.104; most accessible tissue: Callus, score: 82.525	N	N	N	N
vg0704257453	A -> G	LOC_Os07g08320.1	intron_variant ; MODIFIER	silent_mutation	Average:53.104; most accessible tissue: Callus, score: 82.525	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0704257453	NA	2.06E-21	mr1051	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	6.79E-07	mr1058	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	5.27E-16	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	5.41E-25	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	2.28E-17	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	2.85E-12	mr1299	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	3.57E-34	mr1404	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	4.38E-06	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	3.92E-24	mr1551	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	1.79E-30	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	8.93E-08	mr1610	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	1.32E-19	mr1700	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	3.32E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	2.17E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	2.34E-11	mr1883	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	3.19E-15	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	1.07E-37	mr1110_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	1.23E-25	mr1323_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	2.21E-21	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453	NA	9.29E-11	mr1734_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251