\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704257453:

Variant ID: vg0704257453 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4257453
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.00, others allele: 0.00, population size: 182. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTTCAGTCTTATTAGAGTCACAAAACCACCATATGCATATGATATGATCTCTATAAAAGCTAAGTGGATGACACACATAGGCAGTATGTTGGAGAGAG[A/G]
GGGAGAGAGAGACCTGCATATCTTTCTCATCTGGATCATTCAATGGTTCAGCCCATGCAACTCTTATATTCAGGCCTTTGCCAAAAGCATTTTTCTGTGA

Reverse complement sequence

TCACAGAAAAATGCTTTTGGCAAAGGCCTGAATATAAGAGTTGCATGGGCTGAACCATTGAATGATCCAGATGAGAAAGATATGCAGGTCTCTCTCTCCC[T/C]
CTCTCTCCAACATACTGCCTATGTGTGTCATCCACTTAGCTTTTATAGAGATCATATCATATGCATATGGTGGTTTTGTGACTCTAATAAGACTGAAACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 0.80% 14.71% 3.24% NA
All Indica  2759 68.30% 1.40% 24.86% 5.44% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 99.30% 0.00% 0.74% 0.00% NA
Indica I  595 63.50% 1.80% 30.42% 4.20% NA
Indica II  465 64.10% 0.90% 29.46% 5.59% NA
Indica III  913 71.60% 0.90% 21.03% 6.46% NA
Indica Intermediate  786 70.60% 1.90% 22.39% 5.09% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 0.00% 6.67% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704257453 A -> DEL N N silent_mutation Average:53.104; most accessible tissue: Callus, score: 82.525 N N N N
vg0704257453 A -> G LOC_Os07g08300.2 downstream_gene_variant ; 3956.0bp to feature; MODIFIER silent_mutation Average:53.104; most accessible tissue: Callus, score: 82.525 N N N N
vg0704257453 A -> G LOC_Os07g08300.1 downstream_gene_variant ; 4046.0bp to feature; MODIFIER silent_mutation Average:53.104; most accessible tissue: Callus, score: 82.525 N N N N
vg0704257453 A -> G LOC_Os07g08300.3 downstream_gene_variant ; 4042.0bp to feature; MODIFIER silent_mutation Average:53.104; most accessible tissue: Callus, score: 82.525 N N N N
vg0704257453 A -> G LOC_Os07g08300.4 downstream_gene_variant ; 4042.0bp to feature; MODIFIER silent_mutation Average:53.104; most accessible tissue: Callus, score: 82.525 N N N N
vg0704257453 A -> G LOC_Os07g08300.5 downstream_gene_variant ; 4042.0bp to feature; MODIFIER silent_mutation Average:53.104; most accessible tissue: Callus, score: 82.525 N N N N
vg0704257453 A -> G LOC_Os07g08320.1 intron_variant ; MODIFIER silent_mutation Average:53.104; most accessible tissue: Callus, score: 82.525 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704257453 NA 2.06E-21 mr1051 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 6.79E-07 mr1058 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 5.27E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 5.41E-25 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 2.28E-17 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 2.85E-12 mr1299 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 3.57E-34 mr1404 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 4.38E-06 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 3.92E-24 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 1.79E-30 mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 8.93E-08 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 1.32E-19 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 3.32E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 2.17E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 2.34E-11 mr1883 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 3.19E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 1.07E-37 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 1.23E-25 mr1323_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 2.21E-21 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704257453 NA 9.29E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251