\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704019475:

Variant ID: vg0704019475 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4019475
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


CAAAAACTTTACACTCCTGGATCTAAACACCCCCTTTATCATTTAGGCATCCATATGTAGTTTTTATATTATTTGCAGGTAATTTTCAAGGCAACATATT[A/G]
GCTCCGGATTTGAGCACAACTATAAATGCGTGATGAAGATGGAGAGTTTCTAAAAAGTTGCAGGTCGTAAGCTTGAGACGACGGTTATGCAACTTTTTTT

Reverse complement sequence

AAAAAAAGTTGCATAACCGTCGTCTCAAGCTTACGACCTGCAACTTTTTAGAAACTCTCCATCTTCATCACGCATTTATAGTTGTGCTCAAATCCGGAGC[T/C]
AATATGTTGCCTTGAAAATTACCTGCAAATAATATAAAAACTACATATGGATGCCTAAATGATAAAGGGGGTGTTTAGATCCAGGAGTGTAAAGTTTTTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.90% 12.90% 0.21% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 69.70% 29.80% 0.53% 0.00% NA
Aus  269 86.20% 13.40% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 96.90% 3.00% 0.13% 0.00% NA
Tropical Japonica  504 29.40% 69.60% 0.99% 0.00% NA
Japonica Intermediate  241 67.60% 31.50% 0.83% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 80.00% 18.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704019475 A -> G LOC_Os07g07974.1 upstream_gene_variant ; 790.0bp to feature; MODIFIER silent_mutation Average:82.035; most accessible tissue: Minghui63 flag leaf, score: 92.416 N N N N
vg0704019475 A -> G LOC_Os07g07960-LOC_Os07g07974 intergenic_region ; MODIFIER silent_mutation Average:82.035; most accessible tissue: Minghui63 flag leaf, score: 92.416 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0704019475 A G -0.01 0.0 0.0 0.0 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704019475 NA 6.96E-11 mr1084 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704019475 NA 2.29E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704019475 NA 4.17E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704019475 NA 3.38E-06 mr1415 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704019475 NA 3.38E-06 mr1567 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704019475 4.59E-06 NA mr1608 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704019475 NA 2.30E-07 mr1870 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704019475 NA 1.81E-09 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704019475 NA 1.96E-10 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704019475 NA 3.35E-08 mr1554_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704019475 NA 8.98E-09 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251