\
| Variant ID: vg0703978231 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 3978231 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAGTATGTCCCCCATGAAAAATGTAGTGGCTGTGTAAACTGTAAAGTGGATCATGATACAAGTCAGGTCAAACGATAGCTTCAATATTTAAAAAAATGTA[A/G]
TACTATCTCTATATTTTAATGTATGACGCCGTTGATTTTTAATCAAACGTTTAACCATTTATTTTATTCAAAAAAATTTATGTAATTATCATTTTATTTT
AAAATAAAATGATAATTACATAAATTTTTTTGAATAAAATAAATGGTTAAACGTTTGATTAAAAATCAACGGCGTCATACATTAAAATATAGAGATAGTA[T/C]
TACATTTTTTTAAATATTGAAGCTATCGTTTGACCTGACTTGTATCATGATCCACTTTACAGTTTACACAGCCACTACATTTTTCATGGGGGACATACTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.60% | 16.90% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 1.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 69.20% | 29.90% | 0.93% | 0.00% | NA |
| Aus | 269 | 20.80% | 77.30% | 1.86% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.30% | 2.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 96.20% | 3.00% | 0.78% | 0.00% | NA |
| Tropical Japonica | 504 | 34.70% | 64.30% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.20% | 43.60% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0703978231 | A -> G | LOC_Os07g07930.1 | upstream_gene_variant ; 1980.0bp to feature; MODIFIER | silent_mutation | Average:46.165; most accessible tissue: Callus, score: 78.767 | N | N | N | N |
| vg0703978231 | A -> G | LOC_Os07g07910.1 | downstream_gene_variant ; 2406.0bp to feature; MODIFIER | silent_mutation | Average:46.165; most accessible tissue: Callus, score: 78.767 | N | N | N | N |
| vg0703978231 | A -> G | LOC_Os07g07920.1 | downstream_gene_variant ; 514.0bp to feature; MODIFIER | silent_mutation | Average:46.165; most accessible tissue: Callus, score: 78.767 | N | N | N | N |
| vg0703978231 | A -> G | LOC_Os07g07920-LOC_Os07g07930 | intergenic_region ; MODIFIER | silent_mutation | Average:46.165; most accessible tissue: Callus, score: 78.767 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0703978231 | NA | 7.86E-12 | mr1057 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703978231 | NA | 7.73E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703978231 | NA | 7.16E-11 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703978231 | NA | 8.10E-11 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703978231 | NA | 7.18E-13 | mr1189_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703978231 | NA | 3.64E-06 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703978231 | NA | 3.73E-10 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |