\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703938539:

Variant ID: vg0703938539 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 3938539
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


GATGGCAACTGGATCATACCTCACCCACTTCTTGTGGGAGAAGGTCGTAATAGCCCATTGGGCAACATATGAGATGGGTTGGCCAGATTTTCAAGCTAGC[T/C]
AGTATAAGGAGGTGGGCCAAGTAGAAATTGGCCTATTAAAAGGAGTCGGGCACGAACCGTGATTTTGGTCCGAAAACGGCATTTTATTTCAACAGTCCTT

Reverse complement sequence

AAGGACTGTTGAAATAAAATGCCGTTTTCGGACCAAAATCACGGTTCGTGCCCGACTCCTTTTAATAGGCCAATTTCTACTTGGCCCACCTCCTTATACT[A/G]
GCTAGCTTGAAAATCTGGCCAACCCATCTCATATGTTGCCCAATGGGCTATTACGACCTTCTCCCACAAGAAGTGGGTGAGGTATGATCCAGTTGCCATC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.50% 1.70% 8.63% 59.18% NA
All Indica  2759 9.00% 1.40% 5.55% 84.02% NA
All Japonica  1512 72.70% 1.20% 7.80% 18.32% NA
Aus  269 7.40% 3.00% 27.14% 62.45% NA
Indica I  595 7.60% 1.70% 6.72% 84.03% NA
Indica II  465 10.30% 0.60% 3.23% 85.81% NA
Indica III  913 7.20% 1.00% 6.24% 85.54% NA
Indica Intermediate  786 11.30% 2.30% 5.22% 81.17% NA
Temperate Japonica  767 60.60% 2.00% 10.30% 27.12% NA
Tropical Japonica  504 87.10% 0.00% 5.36% 7.54% NA
Japonica Intermediate  241 80.90% 1.20% 4.98% 12.86% NA
VI/Aromatic  96 24.00% 14.60% 58.33% 3.12% NA
Intermediate  90 55.60% 1.10% 8.89% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703938539 T -> DEL N N silent_mutation Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0703938539 T -> C LOC_Os07g07840.1 upstream_gene_variant ; 1679.0bp to feature; MODIFIER silent_mutation Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0703938539 T -> C LOC_Os07g07850.1 upstream_gene_variant ; 321.0bp to feature; MODIFIER silent_mutation Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0703938539 T -> C LOC_Os07g07830.1 downstream_gene_variant ; 4748.0bp to feature; MODIFIER silent_mutation Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0703938539 T -> C LOC_Os07g07850-LOC_Os07g07860 intergenic_region ; MODIFIER silent_mutation Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703938539 8.04E-06 NA mr1089 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703938539 2.56E-06 NA mr1089 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703938539 NA 3.45E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703938539 NA 3.65E-06 mr1387 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703938539 NA 2.39E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703938539 NA 8.93E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703938539 NA 2.28E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703938539 NA 2.72E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251