\
| Variant ID: vg0703938539 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 3938539 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 232. )
GATGGCAACTGGATCATACCTCACCCACTTCTTGTGGGAGAAGGTCGTAATAGCCCATTGGGCAACATATGAGATGGGTTGGCCAGATTTTCAAGCTAGC[T/C]
AGTATAAGGAGGTGGGCCAAGTAGAAATTGGCCTATTAAAAGGAGTCGGGCACGAACCGTGATTTTGGTCCGAAAACGGCATTTTATTTCAACAGTCCTT
AAGGACTGTTGAAATAAAATGCCGTTTTCGGACCAAAATCACGGTTCGTGCCCGACTCCTTTTAATAGGCCAATTTCTACTTGGCCCACCTCCTTATACT[A/G]
GCTAGCTTGAAAATCTGGCCAACCCATCTCATATGTTGCCCAATGGGCTATTACGACCTTCTCCCACAAGAAGTGGGTGAGGTATGATCCAGTTGCCATC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.50% | 1.70% | 8.63% | 59.18% | NA |
| All Indica | 2759 | 9.00% | 1.40% | 5.55% | 84.02% | NA |
| All Japonica | 1512 | 72.70% | 1.20% | 7.80% | 18.32% | NA |
| Aus | 269 | 7.40% | 3.00% | 27.14% | 62.45% | NA |
| Indica I | 595 | 7.60% | 1.70% | 6.72% | 84.03% | NA |
| Indica II | 465 | 10.30% | 0.60% | 3.23% | 85.81% | NA |
| Indica III | 913 | 7.20% | 1.00% | 6.24% | 85.54% | NA |
| Indica Intermediate | 786 | 11.30% | 2.30% | 5.22% | 81.17% | NA |
| Temperate Japonica | 767 | 60.60% | 2.00% | 10.30% | 27.12% | NA |
| Tropical Japonica | 504 | 87.10% | 0.00% | 5.36% | 7.54% | NA |
| Japonica Intermediate | 241 | 80.90% | 1.20% | 4.98% | 12.86% | NA |
| VI/Aromatic | 96 | 24.00% | 14.60% | 58.33% | 3.12% | NA |
| Intermediate | 90 | 55.60% | 1.10% | 8.89% | 34.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0703938539 | T -> DEL | N | N | silent_mutation | Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0703938539 | T -> C | LOC_Os07g07840.1 | upstream_gene_variant ; 1679.0bp to feature; MODIFIER | silent_mutation | Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0703938539 | T -> C | LOC_Os07g07850.1 | upstream_gene_variant ; 321.0bp to feature; MODIFIER | silent_mutation | Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0703938539 | T -> C | LOC_Os07g07830.1 | downstream_gene_variant ; 4748.0bp to feature; MODIFIER | silent_mutation | Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0703938539 | T -> C | LOC_Os07g07850-LOC_Os07g07860 | intergenic_region ; MODIFIER | silent_mutation | Average:25.604; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0703938539 | 8.04E-06 | NA | mr1089 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703938539 | 2.56E-06 | NA | mr1089 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703938539 | NA | 3.45E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703938539 | NA | 3.65E-06 | mr1387 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703938539 | NA | 2.39E-07 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703938539 | NA | 8.93E-06 | mr1289_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703938539 | NA | 2.28E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703938539 | NA | 2.72E-07 | mr1683_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |