\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703879153:

Variant ID: vg0703879153 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 3879153
Reference Allele: CTAlternative Allele: GT,C
Primary Allele: GTSecondary Allele: CT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAAAGAGAACAAAGACAGAAAGGTGCATAAAAGAAAAAGAAAAGCCGCACAAAAAAGAAAATAAAGAAAAACAACAACAACAAAAGTTTTTTTTCCTTA[CT/GT,C]
GGCGAAAAAAACTGTAGATCCGACGGAAAAAAGATTTGATTCATATAAAAGGCAAAAAAAAAAAGTGGTGACAAAAAAAACGCTAGATCCGAATCCTTTA

Reverse complement sequence

TAAAGGATTCGGATCTAGCGTTTTTTTTGTCACCACTTTTTTTTTTTGCCTTTTATATGAATCAAATCTTTTTTCCGTCGGATCTACAGTTTTTTTCGCC[AG/AC,G]
TAAGGAAAAAAAACTTTTGTTGTTGTTGTTTTTCTTTATTTTCTTTTTTGTGCGGCTTTTCTTTTTCTTTTATGCACCTTTCTGTCTTTGTTCTCTTTCT

Allele Frequencies:

Populations Population SizeFrequency of GT(primary allele) Frequency of CT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 12.30% 1.88% 1.10% C: 0.06%
All Indica  2759 93.50% 2.20% 2.61% 1.59% C: 0.04%
All Japonica  1512 65.70% 33.20% 0.46% 0.46% C: 0.13%
Aus  269 97.00% 0.40% 2.23% 0.37% NA
Indica I  595 92.90% 3.90% 0.84% 2.35% NA
Indica II  465 93.80% 3.00% 1.51% 1.51% C: 0.22%
Indica III  913 93.20% 0.20% 5.37% 1.20% NA
Indica Intermediate  786 94.30% 2.80% 1.40% 1.53% NA
Temperate Japonica  767 46.40% 52.20% 0.78% 0.65% NA
Tropical Japonica  504 91.70% 7.50% 0.20% 0.20% C: 0.40%
Japonica Intermediate  241 73.00% 26.60% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 20.00% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703879153 CT -> DEL N N silent_mutation Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818 N N N N
vg0703879153 CT -> GT LOC_Os07g07715.1 upstream_gene_variant ; 1643.0bp to feature; MODIFIER silent_mutation Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818 N N N N
vg0703879153 CT -> GT LOC_Os07g07719.1 upstream_gene_variant ; 4388.0bp to feature; MODIFIER silent_mutation Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818 N N N N
vg0703879153 CT -> GT LOC_Os07g07709.1 downstream_gene_variant ; 4076.0bp to feature; MODIFIER silent_mutation Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818 N N N N
vg0703879153 CT -> GT LOC_Os07g07709-LOC_Os07g07715 intergenic_region ; MODIFIER silent_mutation Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818 N N N N
vg0703879153 CT -> C LOC_Os07g07715.1 upstream_gene_variant ; 1642.0bp to feature; MODIFIER silent_mutation Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818 N N N N
vg0703879153 CT -> C LOC_Os07g07719.1 upstream_gene_variant ; 4387.0bp to feature; MODIFIER silent_mutation Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818 N N N N
vg0703879153 CT -> C LOC_Os07g07709.1 downstream_gene_variant ; 4077.0bp to feature; MODIFIER silent_mutation Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818 N N N N
vg0703879153 CT -> C LOC_Os07g07709-LOC_Os07g07715 intergenic_region ; MODIFIER silent_mutation Average:5.737; most accessible tissue: Zhenshan97 flower, score: 12.818 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703879153 NA 1.84E-14 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0703879153 NA 3.71E-07 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 6.90E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 2.18E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 2.64E-08 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 1.97E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 2.54E-09 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 9.44E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 5.29E-09 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 5.60E-08 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 9.58E-09 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 3.05E-06 3.04E-06 mr1494 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 3.02E-09 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 8.12E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 3.65E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 6.46E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 5.88E-06 mr1604 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 2.33E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 4.96E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 8.41E-06 mr1654 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 1.60E-06 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 9.09E-06 mr1709 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 3.00E-09 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 3.54E-07 mr1748 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 4.23E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 5.86E-06 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 2.51E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 4.53E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 1.23E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 1.22E-07 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703879153 NA 2.04E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251