\
| Variant ID: vg0703855509 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 3855509 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 115. )
ATCATATAAATATCGTTTTTTTTTGACAAATTGATTCGAAAACTTATTTCAAAATTAGAACATGCAAAAAAAAAAGAAAAAAAAACTCCAAGGCGGTTGG[C/T]
GCGTCGAGACTACATCCTTTTTGTTTGAAGTTTTTTCGTGCTTTAGTCTCGAAATAAGTTTTCAAAAAGGACCAATCTATCAAAAAGAAAAGGATAAAAC
GTTTTATCCTTTTCTTTTTGATAGATTGGTCCTTTTTGAAAACTTATTTCGAGACTAAAGCACGAAAAAACTTCAAACAAAAAGGATGTAGTCTCGACGC[G/A]
CCAACCGCCTTGGAGTTTTTTTTTCTTTTTTTTTTGCATGTTCTAATTTTGAAATAAGTTTTCGAATCAATTTGTCAAAAAAAAACGATATTTATATGAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.40% | 37.20% | 1.33% | 0.00% | NA |
| All Indica | 2759 | 60.70% | 38.10% | 1.27% | 0.00% | NA |
| All Japonica | 1512 | 64.00% | 34.20% | 1.79% | 0.00% | NA |
| Aus | 269 | 40.90% | 59.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 68.10% | 29.40% | 2.52% | 0.00% | NA |
| Indica II | 465 | 68.40% | 29.50% | 2.15% | 0.00% | NA |
| Indica III | 913 | 48.50% | 51.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 64.60% | 34.10% | 1.27% | 0.00% | NA |
| Temperate Japonica | 767 | 42.90% | 54.10% | 3.00% | 0.00% | NA |
| Tropical Japonica | 504 | 90.90% | 8.90% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.10% | 23.70% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 2.10% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0703855509 | C -> T | LOC_Os07g07690.1 | upstream_gene_variant ; 4246.0bp to feature; MODIFIER | silent_mutation | Average:43.792; most accessible tissue: Zhenshan97 flower, score: 74.205 | N | N | N | N |
| vg0703855509 | C -> T | LOC_Os07g07690.2 | upstream_gene_variant ; 4246.0bp to feature; MODIFIER | silent_mutation | Average:43.792; most accessible tissue: Zhenshan97 flower, score: 74.205 | N | N | N | N |
| vg0703855509 | C -> T | LOC_Os07g07680-LOC_Os07g07690 | intergenic_region ; MODIFIER | silent_mutation | Average:43.792; most accessible tissue: Zhenshan97 flower, score: 74.205 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0703855509 | NA | 9.92E-13 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0703855509 | NA | 7.66E-09 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703855509 | NA | 4.45E-06 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703855509 | NA | 4.08E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703855509 | NA | 2.62E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703855509 | NA | 7.64E-06 | mr1742 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703855509 | NA | 7.73E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |