Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703851630:

Variant ID: vg0703851630 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 3851630
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACATCATTTTTTGTCCTAGGTGGTAACTTATTTAATGCTATGGACATCATCCTAGTCATTGGGTTGGGAATGCCCTAACCACCCTCTTACCAAATTGGC[C/T]
ACAGTAATTCCTTGACTTTGATGGTAACCAATGCTGCCCTCTTTTTGATTATCATCCTTGTTGGAATAGTTTAGGACTTGATGCTTCACCTAACTGTAAT

Reverse complement sequence

ATTACAGTTAGGTGAAGCATCAAGTCCTAAACTATTCCAACAAGGATGATAATCAAAAAGAGGGCAGCATTGGTTACCATCAAAGTCAAGGAATTACTGT[G/A]
GCCAATTTGGTAAGAGGGTGGTTAGGGCATTCCCAACCCAATGACTAGGATGATGTCCATAGCATTAAATAAGTTACCACCTAGGACAAAAAATGATGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 10.20% 0.30% 0.13% NA
All Indica  2759 99.10% 0.60% 0.18% 0.14% NA
All Japonica  1512 69.30% 30.10% 0.46% 0.13% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 98.50% 0.50% 0.67% 0.34% NA
Indica II  465 98.50% 1.10% 0.22% 0.22% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 0.90% 0.00% 0.13% NA
Temperate Japonica  767 52.20% 46.80% 0.78% 0.26% NA
Tropical Japonica  504 92.10% 7.90% 0.00% 0.00% NA
Japonica Intermediate  241 76.30% 23.20% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 84.40% 14.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703851630 C -> DEL N N silent_mutation Average:71.629; most accessible tissue: Minghui63 root, score: 89.526 N N N N
vg0703851630 C -> T LOC_Os07g07680.1 upstream_gene_variant ; 1306.0bp to feature; MODIFIER silent_mutation Average:71.629; most accessible tissue: Minghui63 root, score: 89.526 N N N N
vg0703851630 C -> T LOC_Os07g07680-LOC_Os07g07690 intergenic_region ; MODIFIER silent_mutation Average:71.629; most accessible tissue: Minghui63 root, score: 89.526 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0703851630 C T -0.06 -0.05 -0.03 -0.02 -0.05 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703851630 NA 4.87E-15 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0703851630 NA 8.58E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 2.68E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 1.68E-06 mr1077 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 9.26E-06 mr1097 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 1.55E-30 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 3.14E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 2.87E-06 mr1149 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 3.76E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 1.15E-07 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 1.91E-07 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 6.55E-10 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 1.11E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 1.05E-08 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 7.13E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 1.03E-08 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 2.53E-10 mr1503 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 4.87E-07 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 3.10E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 4.07E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 2.07E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 3.03E-26 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 5.96E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 1.37E-11 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 2.37E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 1.85E-09 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 9.34E-07 mr1748 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 2.42E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 6.32E-06 mr1794 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 1.35E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 5.05E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 4.03E-32 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 8.24E-10 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 4.75E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 9.36E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 8.99E-06 mr1330_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 2.89E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 6.14E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703851630 NA 6.30E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251